Incidental Mutations

1,185 incidental mutations are currently displayed, and affect 974 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
19 are Probably Benign.
1,148 are Probably Null.
0 create premature stop codons.
1,185 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 1185] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
MGI Phenotype question?
Posted question?
 
1 192678 UTSW 1110017D15Rik R1760 G1 225 Y 4 41507330 T A critical splice acceptor site Het probably null 05/23/2014
2 192500 UTSW 1700001C02Rik R1699 G1 225 N 5 30483866 A G critical splice acceptor site Het probably null 05/14/2014
3 243413 UTSW 1700001C19Rik R2256 G1 217 Y 17 47433423 AC A critical splice acceptor site Het unknown 10/16/2014
4 243483 UTSW 1700001C19Rik R2257 G1 204 Y 17 47433423 AC A critical splice acceptor site Het unknown 10/16/2014
5 273682 UTSW 1700001C19Rik R3498 G1 217 Y 17 47433423 AC A critical splice acceptor site Het unknown 04/02/2015
6 273727 UTSW 1700001C19Rik R3499 G1 217 Y 17 47433423 AC A critical splice acceptor site Het unknown 04/02/2015
7 275564 UTSW 1700001C19Rik R3834 G1 217 Y 17 47433423 AC A critical splice acceptor site Het unknown 04/06/2015
8 275608 UTSW 1700001C19Rik R3835 G1 217 Y 17 47433423 AC A critical splice acceptor site Het unknown 04/06/2015
9 308997 UTSW 1700001C19Rik R3901 G1 217 Y 17 47433423 AC A critical splice acceptor site Het unknown 04/17/2015
10 309355 UTSW 1700001C19Rik R3910 G1 217 Y 17 47433423 AC A critical splice acceptor site Het unknown 04/17/2015
11 309425 UTSW 1700001C19Rik R3911 G1 215 Y 17 47433423 AC A critical splice acceptor site Het unknown 04/17/2015
12 309536 UTSW 1700001C19Rik R3913 G1 217 Y 17 47433423 AC A critical splice acceptor site Het unknown 04/17/2015
13 30249 UTSW 1700011E24Rik R0364 G1 225 Y 17 87389714 T A critical splice acceptor site Het probably null 04/24/2013
14 190952 UTSW 1700023F06Rik R1715 G1 169 N 11 103199824 T C critical splice acceptor site Het probably null 05/14/2014
15 207013 UTSW 1700026D08Rik R1828 G1 225 N 7 83791724 T G critical splice acceptor site Het probably null 06/23/2014
16 39342 UTSW 1700067P10Rik R0445 G1 136 Y 17 48090022 A C critical splice acceptor site Het probably null 05/23/2013
17 100613 UTSW 2010111I01Rik R1209 G1 225 N 13 63191064 A G critical splice acceptor site Het probably null phenotype 01/15/2014
18 89620 APN 2300002M23Rik IGL01527 G1 17 35567833 G T critical splice acceptor site Het probably null 12/03/2013
19 406142 UTSW 2310022A10Rik R4806 G1 225 Y 7 27565645 A G critical splice acceptor site Het probably null 07/28/2016
20 180063 APN 2700062C07Rik IGL01919 G1 18 24475523 A G critical splice acceptor site Het probably null 05/07/2014
21 208042 UTSW 4430402I18Rik R1850 G1 225 Y 19 28939171 T C critical splice acceptor site Het probably null 06/23/2014
22 370200 UTSW 4930430A15Rik R4821 G1 225 Y 2 111204145 T C critical splice acceptor site Het probably null 02/04/2016
23 30068 UTSW 4932425I24Rik R0360 G1 225 Y 16 38298297 T A critical splice acceptor site Het probably null 04/24/2013
24 53494 APN 4932438A13Rik IGL01019 G1 3 37006984 G T critical splice acceptor site Het probably null 06/28/2013
25 212811 UTSW 4932438A13Rik R1919 G1 225 N 3 37006983 A G critical splice acceptor site Het probably null 07/14/2014
26 57694 UTSW 5430403G16Rik R0628 G1 208 Y 5 109678576 T C critical splice acceptor site Het probably null 07/11/2013
27 241496 UTSW 5430419D17Rik R2221 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably null 10/15/2014
28 241616 UTSW 5430419D17Rik R2223 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably null 10/15/2014
29 249756 UTSW 5830473C10Rik R2440 G1 225 N 5 90572689 A G critical splice acceptor site Het probably null 11/12/2014
30 185837 APN 8430419L09Rik IGL02071 G1 6 135227151 A G critical splice acceptor site Het probably null 05/07/2014
31 376254 UTSW 9930111J21Rik1 R4867 G1 225 N 11 48948548 T A critical splice acceptor site Het probably null 03/17/2016
32 166432 UTSW A430105I19Rik R1529 G1 225 N 2 118761760 T A critical splice acceptor site Het probably null 04/13/2014
33 102103 UTSW Aak1 R1141 G1 149 N 6 86965476 G A critical splice acceptor site Het probably null 01/15/2014
34 204589 UTSW Aass R1818 G1 225 N 6 23075858 T A critical splice acceptor site Het probably null 06/23/2014
35 12430 APN Abca12 IGL00813 G1 1 71353762 C A critical splice acceptor site Het probably null phenotype 12/06/2012
36 4474 APN Abca5 IGL00487 G1 11 110309450 T A critical splice acceptor site Het probably null 0.000 phenotype 04/20/2012
37 217018 UTSW Abca8a R1962 G1 222 N 11 110026905 T C critical splice acceptor site Het probably null 08/01/2014
38 204725 UTSW Abca8b R1819 G1 225 Y 11 109981056 T C critical splice acceptor site Het probably null 06/23/2014
39 49312 UTSW Abcb1b R0533 G1 225 Y 5 8864113 A T critical splice acceptor site Het probably null phenotype 06/12/2013
40 261898 UTSW Abcb9 R0458 G1 73 Y 5 124082146 C A critical splice acceptor site Het probably null 02/04/2015
41 275295 UTSW Abcc3 R3824 G1 184 Y 11 94368620 T C critical splice acceptor site Het probably null phenotype 04/02/2015
42 22524 UTSW Abcd4 R0144 G1 225 Y 12 84605965 T A critical splice acceptor site Het probably null 04/16/2013
43 214910 UTSW Abcg8 R1916 G1 225 Y 17 84688530 A T critical splice acceptor site Het probably null phenotype 07/14/2014
44 58394 UTSW Abhd12 R0617 G1 180 Y 2 150846365 T A critical splice acceptor site Het probably null phenotype 07/11/2013
45 76737 UTSW Abi3bp R0783 G1 186 Y 16 56595238 A G critical splice acceptor site Het probably null 10/16/2013
46 172264 UTSW AC092752.1 R1547 G1 225 N 7 14477122 T A critical splice acceptor site Het probably null 04/13/2014
47 266910 UTSW Acaa1a R3418 G1 225 Y 9 119349490 A G critical splice acceptor site Het probably null 02/18/2015
48 48328 UTSW Acaca R0518 G1 225 N 11 84290286 A G critical splice acceptor site Het probably null phenotype 06/12/2013
49 183777 APN Acad9 IGL02016 G1 3 36088486 A T critical splice acceptor site Het probably null 05/07/2014
50 389143 UTSW Acadsb R5020 G1 225 Y 7 131441200 A T critical splice acceptor site Het probably null 06/06/2016
51 209805 UTSW Aco1 R1889 G1 225 Y 4 40164607 A T critical splice acceptor site Het probably null phenotype 06/30/2014
52 93744 UTSW Actb Z0001 105 N 5 142905694 T TG critical splice acceptor site 2 bp Homo probably null phenotype 01/05/2014
53 157015 UTSW Actn1 R1340 G1 224 Y 12 80173144 T C critical splice acceptor site Het probably null 02/11/2014
54 43485 UTSW Adam32 R0189 G1 154 Y 8 24922337 T A critical splice acceptor site Het probably null 05/24/2013
55 36286 UTSW Adamts6 R0362 G1 214 Y 13 104390076 A G critical splice acceptor site Het probably null phenotype 05/09/2013
56 42073 UTSW Adcy4 R0482 G1 225 Y 14 55774572 T A critical splice acceptor site Het probably null phenotype 05/23/2013
57 1004 APN Adgrv1 IGL00090 G1 13 81405408 T G critical splice acceptor site Het probably null phenotype 07/12/2011
58 168020 UTSW Adgrv1 R1507 G1 225 Y 13 81472580 T C critical splice acceptor site Het probably null phenotype 04/13/2014
59 200922 UTSW Adh1 R1464 G1 225 N 3 138288747 A G critical splice acceptor site Het probably null phenotype 05/23/2014
60 231044 UTSW Ago1 R2117 G1 225 N 4 126463857 T A critical splice acceptor site Het probably null phenotype 09/18/2014
61 169062 UTSW Agr3 R1498 G1 225 Y 12 35934380 A T critical splice acceptor site Het probably null 04/13/2014
62 225965 UTSW Agtpbp1 R2001 G1 217 N 13 59475803 TGAAGATGCATCTTGAGAAGA TGAAGA critical splice acceptor site Het probably null phenotype 08/25/2014
63 401408 UTSW Aif1 R5260 G1 225 Y 17 35171941 T A critical splice acceptor site Het probably null phenotype 07/06/2016
64 241049 UTSW Akap8l R2214 G1 225 N 17 32338825 T C critical splice acceptor site Het probably null 10/15/2014
65 44067 UTSW Akap8l V5088 163 N 521 17 32336739 C G critical splice acceptor site Het probably null 05/31/2013
66 82856 UTSW Akr1a1 R0972 G1 225 Y 4 116640007 T C critical splice acceptor site Het probably null phenotype 11/08/2013
67 226869 UTSW Akr1c19 R2068 G1 225 N 13 4238392 A T critical splice acceptor site Het probably null 09/17/2014
68 231826 UTSW Alb R2092 G1 217 N 5 90463983 G GA critical splice acceptor site 1 bp Het probably null phenotype 09/18/2014
69 159344 UTSW Alcam R1433 G1 225 N 16 52295752 T C critical splice acceptor site Het probably null phenotype 03/14/2014
70 35119 UTSW Aldh1a7 R0268 G1 225 Y 19 20709502 T A critical splice acceptor site Het probably null 05/09/2013
71 158100 UTSW Aldh7a1 R1295 G1 225 Y 18 56546950 T C critical splice acceptor site Het probably null phenotype 02/18/2014
72 66098 UTSW Alg8 R0238 G1 147 N 7 97383684 A T critical splice acceptor site Het probably null 08/19/2013
73 59225 UTSW Alg8 R0239 G1 225 Y 7 97383684 A T critical splice acceptor site Het probably null 07/11/2013
74 98646 UTSW Alg8 R1109 G1 225 Y 7 97383684 A T critical splice acceptor site Het probably null 01/05/2014
75 240040 UTSW Alkbh6 R2231 G1 225 N 7 30312590 G A critical splice acceptor site Het probably null 10/15/2014
76 50055 UTSW Alox5 R0543 G1 225 Y 6 116454317 T A critical splice acceptor site Het probably null phenotype 06/12/2013
77 102207 UTSW Alpk2 R1186 G1 225 Y 18 65294341 T C critical splice acceptor site Het probably null 01/15/2014
78 217167 UTSW Als2 R1950 G1 225 N 1 59185601 T A critical splice acceptor site Het probably null phenotype 08/01/2014
79 255433 UTSW Als2cl R2919 G1 225 Y 9 110897499 A T critical splice acceptor site Het probably null 12/29/2014
80 92553 APN Ambra1 IGL01620 G1 2 91911412 A G critical splice acceptor site Het probably null phenotype 12/09/2013
81 92881 APN Amfr IGL01629 G1 8 93987508 T A critical splice acceptor site Het probably null phenotype 12/09/2013
82 401442 UTSW Amfr R5261 G1 225 Y 8 93976170 T A critical splice acceptor site Het probably null phenotype 07/06/2016
83 29899 UTSW Amn R0357 G1 205 Y 12 111274141 A T critical splice acceptor site Het probably null phenotype 04/24/2013
84 201152 UTSW Ampd2 R1466 G1 141 N 3 108080337 T C critical splice acceptor site Het probably null phenotype 05/23/2014
85 177316 UTSW Ampd2 R1584 G1 179 Y 3 108080337 T C critical splice acceptor site Het probably null phenotype 04/24/2014
86 99680 UTSW Amz1 R1173 G1 173 Y 5 140751936 A T critical splice acceptor site Het probably null 01/15/2014
87 236289 UTSW Ankrd32 R2141 G1 225 Y 13 77049219 T A critical splice acceptor site Het probably null phenotype 10/01/2014
88 241231 UTSW Ankrd32 R2217 G1 225 N 13 77046706 T A critical splice acceptor site Het probably null phenotype 10/15/2014
89 244820 UTSW Anks3 R2323 G1 225 N 16 4950770 T C critical splice acceptor site Het probably null 10/30/2014
90 67656 UTSW Ano1 R0732 G1 225 N 7 144619488 T A critical splice acceptor site Het probably null phenotype 09/03/2013
91 237104 UTSW Anxa9 R2180 G1 225 N 3 95306424 T C critical splice acceptor site Het probably null 10/02/2014
92 310425 UTSW Aox2 R3894 G1 225 N 1 58334678 A T critical splice acceptor site Het probably null 04/17/2015
93 235685 UTSW Ap1g2 R2169 G1 225 N 14 55099340 R17* T A critical splice acceptor site Het probably null 10/01/2014
94 189523 UTSW Ap5m1 R1688 G1 225 Y 14 49080834 A G critical splice acceptor site Het probably null 05/14/2014
95 275676 UTSW Apol7d R3837 G1 225 Y 1 71653155 A T critical splice acceptor site Het probably null 04/06/2015
96 186766 UTSW Appbp2 R1661 G1 225 N 11 85210110 T C critical splice acceptor site Het probably null 05/09/2014
97 198025 UTSW Arap3 R1470 G1 225 Y 18 37989196 T C critical splice acceptor site Het probably null phenotype 05/23/2014
98 218306 UTSW Arel1 R1965 G1 225 N 12 84940399 T A critical splice acceptor site Het probably null 08/01/2014
99 181209 APN Arhgef1 IGL01944 G1 7 24925783 G A critical splice acceptor site Het probably null phenotype 05/07/2014
100 173046 UTSW Arhgef2 R1635 G1 225 N 3 88639321 A T critical splice acceptor site Het probably null phenotype 04/24/2014
[records 1 to 100 of 1185] next >> last >|