Incidental Mutations

1,698 incidental mutations are currently displayed, and affect 1,358 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
1,659 are Probably Benign.
27 are Probably Null.
0 create premature stop codons.
1,698 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 1698] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 192678 UTSW 1110017D15Rik 0.074 R1760 G1 225 Y 4 41507330 T A critical splice acceptor site Het probably benign 0.214 phenotype 05/23/2014
2 192500 UTSW 1700001C02Rik 0.155 R1699 G1 225 N 5 30483866 A G critical splice acceptor site Het probably benign 05/14/2014
3 243413 UTSW 1700001C19Rik 0.032 R2256 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 10/16/2014
4 243483 UTSW 1700001C19Rik 0.032 R2257 G1 204 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 10/16/2014
5 273682 UTSW 1700001C19Rik 0.032 R3498 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/02/2015
6 273727 UTSW 1700001C19Rik 0.032 R3499 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/02/2015
7 275564 UTSW 1700001C19Rik 0.032 R3834 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/06/2015
8 275608 UTSW 1700001C19Rik 0.032 R3835 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/06/2015
9 308997 UTSW 1700001C19Rik 0.032 R3901 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/17/2015
10 309355 UTSW 1700001C19Rik 0.032 R3910 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/17/2015
11 309425 UTSW 1700001C19Rik 0.032 R3911 G1 215 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/17/2015
12 309536 UTSW 1700001C19Rik 0.032 R3913 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/17/2015
13 388197 UTSW 1700017D01Rik 0.098 R5099 G1 225 Y 19 11112461 T C critical splice acceptor site Het probably benign 0.650 06/06/2016
14 478683 UTSW 1700019A02Rik 0.125 R6018 G1 225.01 N 1 53163246 C T critical splice acceptor site Het probably benign 06/26/2017
15 190952 UTSW 1700023F06Rik 0.047 R1715 G1 169 N 11 103199824 T C critical splice acceptor site Het probably benign 05/14/2014
16 39342 UTSW 1700067P10Rik 0.033 R0445 G1 136 Y 17 48090022 A C critical splice acceptor site Het probably benign 0.600 05/23/2013
17 100613 UTSW 2010111I01Rik 0.216 R1209 G1 225 N 13 63191064 A G critical splice acceptor site Het probably benign phenotype 01/15/2014
18 379571 UTSW 2010111I01Rik 0.216 R4911 G1 225 Y 13 63170939 A T critical splice acceptor site Het probably benign 0.256 phenotype 04/15/2016
19 26543 UTSW 2010315B03Rik 0.105 P4748 222 N 712 9 124295159 T C critical splice acceptor site Het probably benign 04/16/2013
20 60600 UTSW 2010315B03Rik 0.105 R0090 G1 213 N 9 124295159 T C critical splice acceptor site Het probably benign 07/24/2013
21 60571 UTSW 2010315B03Rik 0.105 R0122 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 07/24/2013
22 22264 UTSW 2010315B03Rik 0.105 R0140 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 04/16/2013
23 500098 UTSW 2010315B03Rik 0.105 R0164 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 12/01/2017
24 31421 UTSW 2010315B03Rik 0.105 R0388 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 04/24/2013
25 76984 UTSW 2010315B03Rik 0.105 R0775 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 10/16/2013
26 76493 UTSW 2010315B03Rik 0.105 R0798 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 10/16/2013
27 406142 UTSW 2310022A10Rik 0.175 R4806 G1 225 Y 7 27565645 A G critical splice acceptor site Het probably benign 0.486 07/28/2016
28 208042 UTSW 4430402I18Rik 0.066 R1850 G1 225 Y 19 28939171 T C critical splice acceptor site Het probably benign 0.486 06/23/2014
29 462735 UTSW 4833423E24Rik 0.101 R5765 G1 225 Y 2 85484194 T G critical splice acceptor site Het probably benign 0.644 03/01/2017
30 382658 UTSW 4921507P07Rik 0.124 R4976 G1 225 N 6 50589184 T A critical splice acceptor site Het probably benign 04/27/2016
31 318775 UTSW 4921524L21Rik 0.211 R4201 G1 225 N 18 6623952 A G critical splice acceptor site Het probably benign 06/10/2015
32 370200 UTSW 4930430A15Rik 0.048 R4821 G1 225 Y 2 111204145 T C critical splice acceptor site Het probably benign 0.476 02/04/2016
33 507928 UTSW 4930452B06Rik 0.114 R6280 G1 225.01 Y 14 8473414 T G critical splice acceptor site Het probably benign 03/15/2018
34 434933 UTSW 4930467E23Rik R5538 G1 225 N 8 19749414 A C critical splice acceptor site Het probably benign 10/24/2016
35 482208 UTSW 4930579C12Rik 0.100 R5454 G1 225 Y 9 89168988 T C critical splice acceptor site Het noncoding transcript 07/11/2017
36 511096 UTSW 4932438A13Rik 0.864 FR4340 217.47 N 3 37050752 TATTATTAT TATTATTATTATTATCATTATTAT critical splice acceptor site Het probably benign phenotype 04/05/2018
37 511596 UTSW 4932438A13Rik 0.864 FR4737 217.47 N 3 37050754 TTATTAT TTATTATTATTATTACTATTAT critical splice acceptor site Het probably benign phenotype 04/05/2018
38 212811 UTSW 4932438A13Rik 0.864 R1919 G1 225 N 3 37006983 A G critical splice acceptor site Het probably benign phenotype 07/14/2014
39 57694 UTSW 5430403G16Rik 0.103 R0628 G1 208 Y 5 109678576 T C critical splice acceptor site Het probably benign 0.520 07/11/2013
40 241496 UTSW 5430419D17Rik 0.040 R2221 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably benign 0.612 10/15/2014
41 241616 UTSW 5430419D17Rik 0.040 R2223 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably benign 0.612 10/15/2014
42 249756 UTSW 5830473C10Rik 0.264 R2440 G1 225 N 5 90572689 A G critical splice acceptor site Het probably benign 11/12/2014
43 376254 UTSW 9930111J21Rik1 0.160 R4867 G1 225 N 11 48948548 T A critical splice acceptor site Het probably benign 03/17/2016
44 436215 UTSW A2ml1 0.242 R5532 G1 225 N 6 128553330 T A critical splice acceptor site Het probably benign 10/24/2016
45 166432 UTSW A430105I19Rik 0.071 R1529 G1 225 N 2 118761760 T A critical splice acceptor site Het probably benign 04/13/2014
46 391994 UTSW A530016L24Rik 0.025 IGL02835 G1 153 Y 12 112494986 A C critical splice acceptor site Het probably benign 0.644 06/08/2016
47 345326 UTSW A830018L16Rik 0.156 R4598 G1 225 N 1 11747964 G A critical splice acceptor site Het probably benign phenotype 09/25/2015
48 479514 UTSW A830018L16Rik 0.156 R6007 G1 225.01 Y 1 11511916 A G critical splice acceptor site Het probably benign 0.522 phenotype 06/26/2017
49 102103 UTSW Aak1 0.510 R1141 G1 149 N 6 86965476 G A critical splice acceptor site Het probably benign phenotype 01/15/2014
50 479868 UTSW Aanat 0.076 R6013 G1 225.01 Y 11 116596124 A T critical splice acceptor site Het probably benign 0.458 phenotype 06/26/2017
51 204589 UTSW Aass 0.416 R1818 G1 225 N 6 23075858 T A critical splice acceptor site Het probably benign phenotype 06/23/2014
52 489401 UTSW Abca13 0.134 R6153 G1 225.01 Y 11 9301259 G T critical splice acceptor site Het probably benign 0.480 phenotype 10/10/2017
53 349067 UTSW Abca6 0.089 R4629 G1 225 N 11 110230549 T C critical splice acceptor site Het probably benign phenotype 10/08/2015
54 217018 UTSW Abca8a 0.107 R1962 G1 222 N 11 110026905 T C critical splice acceptor site Het probably benign 08/01/2014
55 486155 UTSW Abca8a 0.107 R6090 G1 225.01 N 11 110063222 T C critical splice acceptor site Het probably benign 08/16/2017
56 204725 UTSW Abca8b 0.268 R1819 G1 225 Y 11 109981056 T C critical splice acceptor site Het probably benign 0.308 phenotype 06/23/2014
57 49312 UTSW Abcb1b 0.320 R0533 G1 225 Y 5 8864113 A T critical splice acceptor site Het probably benign 0.598 phenotype 06/12/2013
58 314451 UTSW Abcb4 0.000 R4112 G1 225 Y 5 8936783 A G critical splice acceptor site Het probably benign 0.248 phenotype 05/14/2015
59 346036 UTSW Abcb5 0.274 R4606 G1 225 Y 12 118932610 T C critical splice acceptor site Het probably benign 0.582 phenotype 09/25/2015
60 521932 UTSW Abcb6 0.610 R6527 G1 225.01 N 1 75177488 T C critical splice acceptor site Het probably benign phenotype 06/06/2018
61 261898 UTSW Abcb9 0.179 R0458 G1 73 Y 5 124082146 C A critical splice acceptor site Het probably benign 0.568 phenotype 02/04/2015
62 275295 UTSW Abcc3 0.303 R3824 G1 184 Y 11 94368620 T C critical splice acceptor site Het probably benign 0.252 phenotype 04/02/2015
63 448782 UTSW Abcc9 0.311 R5802 G1 225 Y 6 142656676 C A critical splice acceptor site Het probably benign 0.568 phenotype 12/15/2016
64 22524 UTSW Abcd4 0.243 R0144 G1 225 Y 12 84605965 T A critical splice acceptor site Het probably benign 0.572 phenotype 04/16/2013
65 214910 UTSW Abcg8 0.000 R1916 G1 225 Y 17 84688530 A T critical splice acceptor site Het probably benign 0.470 phenotype 07/14/2014
66 58394 UTSW Abhd12 0.271 R0617 G1 180 Y 2 150846365 T A critical splice acceptor site Het probably benign 0.452 phenotype 07/11/2013
67 316602 UTSW Abhd12 0.271 R4077 G1 225 Y 2 150848459 T A critical splice acceptor site Het probably benign 0.536 phenotype 05/15/2015
68 76737 UTSW Abi3bp 0.195 R0783 G1 186 Y 16 56595238 A G critical splice acceptor site Het probably benign 0.226 10/16/2013
69 61397 UTSW Abraxas2 0.343 R0670 G1 113 N 7 132869031 A T critical splice acceptor site Het probably benign 07/30/2013
70 440160 UTSW Abtb2 0.377 R5513 G1 203 Y 2 103709278 A T critical splice acceptor site Het probably benign 0.466 11/08/2016
71 266910 UTSW Acaa1a 0.359 R3418 G1 225 Y 9 119349490 A G critical splice acceptor site Het probably benign 0.564 phenotype 02/18/2015
72 48328 UTSW Acaca 1.000 R0518 G1 225 N 11 84290286 A G critical splice acceptor site Het probably benign phenotype 06/12/2013
73 524617 UTSW Acaca 1.000 R6623 G1 225.01 N 11 84371499 A C critical splice acceptor site Het probably benign phenotype 06/22/2018
74 326220 UTSW Acacb 0.000 R4386 G1 207 Y 5 114241921 A T critical splice acceptor site Het probably benign 0.266 phenotype 07/06/2015
75 389143 UTSW Acadsb 0.156 R5020 G1 225 Y 7 131441200 A T critical splice acceptor site Het probably benign 0.248 phenotype 06/06/2016
76 484254 UTSW Acap1 0.000 R6053 G1 225.01 N 11 69887070 T G critical splice acceptor site Het probably benign 07/14/2017
77 330387 UTSW Accsl 0.111 R4472 G1 225 Y 2 93863991 T A critical splice acceptor site Het probably benign 0.486 07/21/2015
78 209805 UTSW Aco1 0.587 R1889 G1 225 Y 4 40164607 A T critical splice acceptor site Het probably benign 0.238 phenotype 06/30/2014
79 487573 UTSW Acsm2 0.102 R6129 G1 225.01 Y 7 119591247 G A critical splice acceptor site Het probably benign 10/10/2017
80 523065 UTSW Acsm3 0.000 R6497 G1 225.01 N 7 119780749 G A critical splice acceptor site Het probably benign phenotype 06/06/2018
81 157015 UTSW Actn1 0.512 R1340 G1 224 Y 12 80173144 T C critical splice acceptor site Het probably benign 0.244 phenotype 02/11/2014
82 402748 UTSW Actn2 0.617 R5228 G1 225 N 13 12288659 T C critical splice acceptor site Het probably benign phenotype 07/22/2016
83 462619 UTSW Actn3 0.000 R5753 G1 225 Y 19 4864567 T C critical splice acceptor site Het probably benign 0.508 phenotype 03/01/2017
84 43485 UTSW Adam32 0.128 R0189 G1 154 Y 8 24922337 T A critical splice acceptor site Het probably benign 0.464 phenotype 05/24/2013
85 527180 UTSW Adam7 0.095 R6672 G1 225.01 N 14 68504702 T A critical splice acceptor site Het probably benign phenotype 07/23/2018
86 36286 UTSW Adamts6 0.760 R0362 G1 214 Y 13 104390076 A G critical splice acceptor site Het probably benign 0.530 phenotype 05/09/2013
87 427459 UTSW Adamtsl1 0.192 R5411 G1 225 N 4 86388413 G A critical splice acceptor site Het probably benign phenotype 09/01/2016
88 42073 UTSW Adcy4 0.000 R0482 G1 225 Y 14 55774572 T A critical splice acceptor site Het probably benign 0.526 phenotype 05/23/2013
89 435084 UTSW Adgrb2 0.000 R5550 G1 225 N 4 130014934 G T critical splice acceptor site Het probably benign phenotype 10/24/2016
90 357788 UTSW Adgrf3 0.115 R4754 G1 225 Y 5 30197617 T A critical splice acceptor site Het probably null 0.472 11/11/2015
91 168020 UTSW Adgrv1 0.000 R1507 G1 225 Y 13 81472580 T C critical splice acceptor site Het probably benign 0.452 phenotype 04/13/2014
92 200922 UTSW Adh1 0.000 R1464 G1 225 N 3 138288747 A G critical splice acceptor site Het probably benign phenotype 05/23/2014
93 383896 UTSW Agfg2 0.135 R4965 G1 225 N 5 137667177 C A critical splice acceptor site Het probably benign phenotype 04/27/2016
94 231044 UTSW Ago1 0.509 R2117 G1 225 N 4 126463857 T A critical splice acceptor site Het probably benign phenotype 09/18/2014
95 449014 UTSW Ago2 1.000 R5815 G1 225 N 15 73107366 T C critical splice acceptor site Het probably benign phenotype 12/20/2016
96 169062 UTSW Agr3 0.130 R1498 G1 225 Y 12 35934380 A T critical splice acceptor site Het probably benign 0.594 phenotype 04/13/2014
97 401408 UTSW Aif1 0.469 R5260 G1 225 Y 17 35171941 T A critical splice acceptor site Het probably benign 0.047 phenotype 07/06/2016
98 315783 UTSW Akap6 0.621 R4042 G1 195 N 12 53139379 A T critical splice acceptor site Het probably benign phenotype 05/15/2015
99 241049 UTSW Akap8l 0.668 R2214 G1 225 N 17 32338825 T C critical splice acceptor site Het probably benign 10/15/2014
100 44067 UTSW Akap8l 0.668 V5088 163 N 521 17 32336739 C G critical splice acceptor site Het probably benign 05/31/2013
[records 1 to 100 of 1698] next >> last >|