Incidental Mutations

1,199 incidental mutations are currently displayed, and affect 943 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
6 are Probably Benign.
1,141 are Probably Null.
0 create premature stop codons.
1,199 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 1199] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
MGI Phenotype question?
Posted question?
 
1 192678 UTSW 1110017D15Rik R1760 G1 225 Y 4 41507330 T A critical splice acceptor site Het probably null 05/23/2014
2 192500 UTSW 1700001C02Rik R1699 G1 225 N 5 30483866 A G critical splice acceptor site Het probably null 05/14/2014
3 243413 UTSW 1700001C19Rik R2256 G1 217 Y 17 47433423 AC A critical splice acceptor site Het noncoding transcript 10/16/2014
4 243483 UTSW 1700001C19Rik R2257 G1 204 Y 17 47433423 AC A critical splice acceptor site Het noncoding transcript 10/16/2014
5 273682 UTSW 1700001C19Rik R3498 G1 217 Y 17 47433423 AC A critical splice acceptor site Het noncoding transcript 04/02/2015
6 273727 UTSW 1700001C19Rik R3499 G1 217 Y 17 47433423 AC A critical splice acceptor site Het noncoding transcript 04/02/2015
7 275564 UTSW 1700001C19Rik R3834 G1 217 Y 17 47433423 AC A critical splice acceptor site Het noncoding transcript 04/06/2015
8 275608 UTSW 1700001C19Rik R3835 G1 217 Y 17 47433423 AC A critical splice acceptor site Het noncoding transcript 04/06/2015
9 308997 UTSW 1700001C19Rik R3901 G1 217 Y 17 47433423 AC A critical splice acceptor site Het noncoding transcript 04/17/2015
10 309355 UTSW 1700001C19Rik R3910 G1 217 Y 17 47433423 AC A critical splice acceptor site Het noncoding transcript 04/17/2015
11 309425 UTSW 1700001C19Rik R3911 G1 215 Y 17 47433423 AC A critical splice acceptor site Het noncoding transcript 04/17/2015
12 309536 UTSW 1700001C19Rik R3913 G1 217 Y 17 47433423 AC A critical splice acceptor site Het noncoding transcript 04/17/2015
13 30249 UTSW 1700011E24Rik R0364 G1 225 Y 17 87389714 T A critical splice acceptor site Het probably null 04/24/2013
14 478683 UTSW 1700019A02Rik R6018 G1 225.01 N 1 53163246 C T critical splice acceptor site Het probably null 06/26/2017
15 190952 UTSW 1700023F06Rik R1715 G1 169 N 11 103199824 T C critical splice acceptor site Het probably null 05/14/2014
16 207013 UTSW 1700026D08Rik R1828 G1 225 N 7 83791724 T G critical splice acceptor site Het probably null 06/23/2014
17 39342 UTSW 1700067P10Rik R0445 G1 136 Y 17 48090022 A C critical splice acceptor site Het probably null 05/23/2013
18 100613 UTSW 2010111I01Rik R1209 G1 225 N 13 63191064 A G critical splice acceptor site Het probably null phenotype 01/15/2014
19 26543 UTSW 2010315B03Rik P4748 222 N 712 9 124295159 T C critical splice acceptor site Het probably null 04/16/2013
20 60600 UTSW 2010315B03Rik R0090 G1 213 N 9 124295159 T C critical splice acceptor site Het probably null 07/24/2013
21 60571 UTSW 2010315B03Rik R0122 G1 222 N 9 124295159 T C critical splice acceptor site Het probably null 07/24/2013
22 22264 UTSW 2010315B03Rik R0140 G1 222 N 9 124295159 T C critical splice acceptor site Het probably null 04/16/2013
23 24351 UTSW 2010315B03Rik R0164 G1 222 N 9 124295159 T C critical splice acceptor site Het probably null 04/16/2013
24 31421 UTSW 2010315B03Rik R0388 G1 222 N 9 124295159 T C critical splice acceptor site Het probably null 04/24/2013
25 406142 UTSW 2310022A10Rik R4806 G1 225 Y 7 27565645 A G critical splice acceptor site Het probably null 07/28/2016
26 208042 UTSW 4430402I18Rik R1850 G1 225 Y 19 28939171 T C critical splice acceptor site Het probably null 06/23/2014
27 382658 UTSW 4921507P07Rik R4976 G1 225 N 6 50589184 T A critical splice acceptor site Het probably null 04/27/2016
28 370200 UTSW 4930430A15Rik R4821 G1 225 Y 2 111204145 T C critical splice acceptor site Het probably null 02/04/2016
29 434933 UTSW 4930467E23Rik R5538 G1 225 N 8 19749414 A C critical splice acceptor site Het probably null 10/24/2016
30 482208 UTSW 4930579C12Rik R5454 G1 225 Y 9 89168988 T C critical splice acceptor site Het noncoding transcript 07/11/2017
31 212811 UTSW 4932438A13Rik R1919 G1 225 N 3 37006983 A G critical splice acceptor site Het probably null 07/14/2014
32 57694 UTSW 5430403G16Rik R0628 G1 208 Y 5 109678576 T C critical splice acceptor site Het probably null 07/11/2013
33 494967 UTSW 5430419D17Rik JAX1 G1 182.96 N 7 131247457 A T critical splice acceptor site Het probably null 11/21/2017
34 241496 UTSW 5430419D17Rik R2221 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably null 10/15/2014
35 241616 UTSW 5430419D17Rik R2223 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably null 10/15/2014
36 249756 UTSW 5830473C10Rik R2440 G1 225 N 5 90572689 A G critical splice acceptor site Het probably null 11/12/2014
37 376254 UTSW 9930111J21Rik1 R4867 G1 225 N 11 48948548 T A critical splice acceptor site Het probably null 03/17/2016
38 166432 UTSW A430105I19Rik R1529 G1 225 N 2 118761760 T A critical splice acceptor site Het probably null 04/13/2014
39 391994 UTSW A530016L24Rik IGL02835 G1 153 Y 12 112494986 A C critical splice acceptor site Het probably null 06/08/2016
40 490988 UTSW A530032D15Rik JAX1 G1 119 N 1 85091190 C T critical splice acceptor site Het unknown 11/21/2017
41 479514 UTSW A830018L16Rik R6007 G1 225.01 N 1 11511916 A G critical splice acceptor site Het probably null 06/26/2017
42 102103 UTSW Aak1 R1141 G1 149 N 6 86965476 G A critical splice acceptor site Het probably null 01/15/2014
43 479868 UTSW Aanat R6013 G1 225.01 N 11 116596124 A T critical splice acceptor site Het probably null phenotype 06/26/2017
44 204589 UTSW Aass R1818 G1 225 N 6 23075858 T A critical splice acceptor site Het probably null 06/23/2014
45 489401 UTSW Abca13 R6153 G1 225.01 N 11 9301259 G T critical splice acceptor site Het probably null 10/10/2017
46 217018 UTSW Abca8a R1962 G1 222 N 11 110026905 T C critical splice acceptor site Het probably null 08/01/2014
47 486155 UTSW Abca8a R6090 G1 225.01 N 11 110063222 T C critical splice acceptor site Het probably null 08/16/2017
48 204725 UTSW Abca8b R1819 G1 225 Y 11 109981056 T C critical splice acceptor site Het probably null 06/23/2014
49 49312 UTSW Abcb1b R0533 G1 225 Y 5 8864113 A T critical splice acceptor site Het probably null phenotype 06/12/2013
50 261898 UTSW Abcb9 R0458 G1 73 Y 5 124082146 C A critical splice acceptor site Het probably null 02/04/2015
51 275295 UTSW Abcc3 R3824 G1 184 Y 11 94368620 T C critical splice acceptor site Het probably null phenotype 04/02/2015
52 22524 UTSW Abcd4 R0144 G1 225 Y 12 84605965 T A critical splice acceptor site Het probably null 04/16/2013
53 214910 UTSW Abcg8 R1916 G1 225 Y 17 84688530 A T critical splice acceptor site Het probably null phenotype 07/14/2014
54 58394 UTSW Abhd12 R0617 G1 180 Y 2 150846365 T A critical splice acceptor site Het probably null phenotype 07/11/2013
55 76737 UTSW Abi3bp R0783 G1 186 Y 16 56595238 A G critical splice acceptor site Het probably null 10/16/2013
56 440160 UTSW Abtb2 R5513 G1 203 Y 2 103709278 A T critical splice acceptor site Het probably null 11/08/2016
57 172264 UTSW AC092752.1 R1547 G1 225 N 7 14477122 T A critical splice acceptor site Het probably null 04/13/2014
58 266910 UTSW Acaa1a R3418 G1 225 Y 9 119349490 A G critical splice acceptor site Het probably null 02/18/2015
59 48328 UTSW Acaca R0518 G1 225 N 11 84290286 A G critical splice acceptor site Het probably null phenotype 06/12/2013
60 389143 UTSW Acadsb R5020 G1 225 Y 7 131441200 A T critical splice acceptor site Het probably null 06/06/2016
61 484254 UTSW Acap1 R6053 G1 225.01 N 11 69887070 T G critical splice acceptor site Het probably null 07/14/2017
62 209805 UTSW Aco1 R1889 G1 225 Y 4 40164607 A T critical splice acceptor site Het probably null phenotype 06/30/2014
63 487573 UTSW Acsm2 R6129 G1 225.01 N 7 119591247 G A critical splice acceptor site Het probably null 10/10/2017
64 93744 UTSW Actb Z0001 105 N 5 142905694 T TG critical splice acceptor site Homo noncoding transcript phenotype 01/05/2014
65 157015 UTSW Actn1 R1340 G1 224 Y 12 80173144 T C critical splice acceptor site Het probably null 02/11/2014
66 43485 UTSW Adam32 R0189 G1 154 Y 8 24922337 T A critical splice acceptor site Het probably null 05/24/2013
67 36286 UTSW Adamts6 R0362 G1 214 Y 13 104390076 A G critical splice acceptor site Het probably null phenotype 05/09/2013
68 42073 UTSW Adcy4 R0482 G1 225 Y 14 55774572 T A critical splice acceptor site Het probably null phenotype 05/23/2013
69 168020 UTSW Adgrv1 R1507 G1 225 Y 13 81472580 T C critical splice acceptor site Het probably null phenotype 04/13/2014
70 200922 UTSW Adh1 R1464 G1 225 N 3 138288747 A G critical splice acceptor site Het probably null phenotype 05/23/2014
71 383896 UTSW Agfg2 R4965 G1 225 N 5 137667177 C A critical splice acceptor site Het probably null 04/27/2016
72 231044 UTSW Ago1 R2117 G1 225 N 4 126463857 T A critical splice acceptor site Het probably null phenotype 09/18/2014
73 169062 UTSW Agr3 R1498 G1 225 Y 12 35934380 A T critical splice acceptor site Het probably null 04/13/2014
74 225965 UTSW Agtpbp1 R2001 G1 217 N 13 59475803 TGAAGATGCATCTTGAGAAGA TGAAGA critical splice acceptor site Het probably null phenotype 08/25/2014
75 401408 UTSW Aif1 R5260 G1 225 Y 17 35171941 T A critical splice acceptor site Het probably null phenotype 07/06/2016
76 241049 UTSW Akap8l R2214 G1 225 N 17 32338825 T C critical splice acceptor site Het probably null 10/15/2014
77 44067 UTSW Akap8l V5088 163 N 521 17 32336739 C G critical splice acceptor site Het probably null 05/31/2013
78 82856 UTSW Akr1a1 R0972 G1 225 Y 4 116640007 T C critical splice acceptor site Het probably null phenotype 11/08/2013
79 226869 UTSW Akr1c19 R2068 G1 225 N 13 4238392 A T critical splice acceptor site Het probably null 09/17/2014
80 231826 UTSW Alb R2092 G1 217 N 5 90463983 G GA critical splice acceptor site Het probably null phenotype 09/18/2014
81 159344 UTSW Alcam R1433 G1 225 N 16 52295752 T C critical splice acceptor site Het probably null phenotype 03/14/2014
82 35119 UTSW Aldh1a7 R0268 G1 225 Y 19 20709502 T A critical splice acceptor site Het probably null 05/09/2013
83 158100 UTSW Aldh7a1 R1295 G1 225 Y 18 56546950 T C critical splice acceptor site Het probably null phenotype 02/18/2014
84 382641 UTSW Alg6 R4976 G1 225 N 4 99750728 G A critical splice acceptor site Het probably null 04/27/2016
85 494743 UTSW Alg8 JAX1 G1 225 N 7 97383684 A T critical splice acceptor site Het probably null 11/21/2017
86 66098 UTSW Alg8 R0238 G1 147 N 7 97383684 A T critical splice acceptor site Het probably null 08/19/2013
87 59225 UTSW Alg8 R0239 G1 225 Y 7 97383684 A T critical splice acceptor site Het probably null 07/11/2013
88 98646 UTSW Alg8 R1109 G1 225 Y 7 97383684 A T critical splice acceptor site Het probably null 01/05/2014
89 240040 UTSW Alkbh6 R2231 G1 225 N 7 30312590 G A critical splice acceptor site Het probably null 10/15/2014
90 50055 UTSW Alox5 R0543 G1 225 Y 6 116454317 T A critical splice acceptor site Het probably null phenotype 06/12/2013
91 102207 UTSW Alpk2 R1186 G1 225 Y 18 65294341 T C critical splice acceptor site Het probably null 01/15/2014
92 217167 UTSW Als2 R1950 G1 225 N 1 59185601 T A critical splice acceptor site Het probably null phenotype 08/01/2014
93 255433 UTSW Als2cl R2919 G1 225 Y 9 110897499 A T critical splice acceptor site Het probably null 12/29/2014
94 401442 UTSW Amfr R5261 G1 225 Y 8 93976170 T A critical splice acceptor site Het probably null phenotype 07/06/2016
95 29899 UTSW Amn R0357 G1 205 Y 12 111274141 A T critical splice acceptor site Het probably null phenotype 04/24/2013
96 201152 UTSW Ampd2 R1466 G1 141 N 3 108080337 T C critical splice acceptor site Het probably null phenotype 05/23/2014
97 177316 UTSW Ampd2 R1584 G1 179 Y 3 108080337 T C critical splice acceptor site Het probably null phenotype 04/24/2014
98 99680 UTSW Amz1 R1173 G1 173 Y 5 140751936 A T critical splice acceptor site Het probably null 01/15/2014
99 236289 UTSW Ankrd32 R2141 G1 225 Y 13 77049219 T A critical splice acceptor site Het probably null phenotype 10/01/2014
100 241231 UTSW Ankrd32 R2217 G1 225 N 13 77046706 T A critical splice acceptor site Het probably null phenotype 10/15/2014
[records 1 to 100 of 1199] next >> last >|