Incidental Mutations

1,264 incidental mutations are currently displayed, and affect 426 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
0 are Probably Benign.
1,260 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 1264] next >> last >| per page Full List
ID question?
Source question?
Gene question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
MGI Phenotype question?
Posted question?
1 437139 UTSW 3110002H16Rik R5574 G1 217 N 18 12185006 CTGTGTGTT CTGTGTGTTGTGTGTT frame shift Het probably null 10/26/2016
4 244184 UTSW 4732465J04Rik R2288 G1 138 N 10 95793815 TATC TATCCATC frame shift Het probably null 10/30/2014
5 244185 UTSW 4732465J04Rik R2288 G1 143 N 10 95793827 TATC TATCCATC frame shift Het probably null 10/30/2014
6 56364 UTSW 4921517D22Rik R0579 G1 212 Y 13 59691598 GCC GC frame shift Het probably null 07/11/2013
7 61952 UTSW 4921517D22Rik R0664 G1 100 Y 13 59691598 GCC GC frame shift Het probably null 07/30/2013
8 69481 UTSW 4921517D22Rik R0757 G1 217 N 13 59691598 GCC GC frame shift Het probably null 09/30/2013
9 69488 UTSW 4921517D22Rik R0758 G1 217 N 13 59691598 GCC GC frame shift Het probably null 09/30/2013
10 76990 UTSW 4921517D22Rik R0777 G1 217 N 13 59691598 GCC GC frame shift Het probably null 10/16/2013
11 76569 UTSW 4921517D22Rik R0779 G1 217 N 13 59691598 GCC GC frame shift Het probably null 10/16/2013
12 78548 UTSW 4921517D22Rik R0814 G1 217 N 13 59691598 GCC GC frame shift Het probably null 10/16/2013
13 81632 UTSW 4921517D22Rik R0870 G1 217 N 13 59691598 GCC GC frame shift Het probably null 11/08/2013
14 81639 UTSW 4921517D22Rik R0872 G1 217 N 13 59691598 GCC GC frame shift Het probably null 11/08/2013
15 81644 UTSW 4921517D22Rik R0873 G1 217 N 13 59691598 GCC GC frame shift Het probably null 11/08/2013
16 100263 UTSW 4921517D22Rik R1062 G1 217 N 13 59691598 GCC GC frame shift Het probably null 01/15/2014
17 85947 UTSW 4921517D22Rik R1064 G1 217 N 13 59691598 GCC GC frame shift Het probably null 11/18/2013
18 165230 UTSW 4921517D22Rik R1149 G1 217 N 13 59691598 GCC GC frame shift Het probably null 03/28/2014
19 101604 UTSW 4921517D22Rik R1151 G1 217 N 13 59691598 GCC GC frame shift Het probably null 01/15/2014
20 101621 UTSW 4921517D22Rik R1152 G1 217 N 13 59691598 GCC GC frame shift Het probably null 01/15/2014
21 164807 UTSW 4921517D22Rik R1207 G1 217 N 13 59691598 GCC GC frame shift Het probably null 03/28/2014
22 150657 UTSW 4921517D22Rik R1285 G1 217 N 13 59691598 GCC GC frame shift Het probably null 01/29/2014
23 156968 UTSW 4921517D22Rik R1339 G1 217 N 13 59691598 GCC GC frame shift Het probably null 02/11/2014
24 156230 UTSW 4921517D22Rik R1358 G1 217 N 13 59691598 GCC GC frame shift Het probably null 02/11/2014
25 156371 UTSW 4921517D22Rik R1359 G1 217 N 13 59691598 GCC GC frame shift Het probably null 02/11/2014
26 156376 UTSW 4921517D22Rik R1360 G1 217 N 13 59691598 GCC GC frame shift Het probably null 02/11/2014
27 156378 UTSW 4921517D22Rik R1361 G1 217 N 13 59691598 GCCGACC GCGACC frame shift Het probably null 02/11/2014
28 188366 UTSW 4921517D22Rik R1679 G1 217 Y 13 59691598 GCC GC frame shift Het probably null 05/09/2014
29 206415 UTSW 4930544D05Rik E0370 G1 209 Y 11 70616426 TGCAGCGACTGGACGGCGGCA TGCA frame shift Het probably null phenotype 06/23/2014
30 262166 UTSW 4930556J24Rik T0975 G3 211 N 714 11 3937945 TAA TAAA frame shift Het probably null 02/04/2015
32 453291 UTSW 4933416I08Rik IGL02984 G1 217 Y X 53690895 TCC TCCC frame shift Het probably null 02/01/2017
33 453523 UTSW 4933416I08Rik IGL02988 G1 217 Y X 53690895 TCC TCCC frame shift Het probably null 02/08/2017
34 452956 UTSW 4933416I08Rik IGL02991 G1 165 Y X 53690895 TCC TCCC frame shift Het probably null 01/24/2017
35 453344 UTSW 4933416I08Rik IGL03014 G1 217 Y X 53690895 TCC TCCC frame shift Het probably null 02/01/2017
36 453454 UTSW 4933416I08Rik IGL03050 G1 217 Y X 53690895 TCC TCCC frame shift Het probably null 02/08/2017
37 453040 UTSW 4933416I08Rik IGL03054 G1 217 Y X 53690895 TCC TCCC frame shift Het probably null 01/24/2017
38 453408 UTSW 4933416I08Rik IGL03055 G1 217 Y X 53690895 TCC TCCC frame shift Het probably null 02/03/2017
39 453246 UTSW 4933416I08Rik IGL03097 G1 147 Y X 53690895 TCC TCCC frame shift Het probably null 01/31/2017
40 453004 UTSW 4933416I08Rik IGL03098 G1 217 Y X 53690895 TCC TCCC frame shift Het probably null 01/24/2017
41 453195 UTSW 4933416I08Rik IGL03134 G1 122 Y X 53690895 TCC TCCC frame shift Het probably null 01/30/2017
42 453092 UTSW 4933416I08Rik IGL03138 G1 215 Y X 53690895 TCC TCCC frame shift Het probably null 01/27/2017
43 453134 UTSW 4933416I08Rik IGL03147 G1 217 Y X 53690895 TCC TCCC frame shift Het probably null 01/27/2017
44 429653 UTSW A430005L14Rik R5396 G1 188 N 4 153960953 GCC G frame shift Het probably null 09/06/2016
45 216562 UTSW Abca1 R1945 G1 117 N 4 53061509 ACGTCTTCACCAGGTAATC AC frame shift Het probably null phenotype 08/01/2014
46 389233 UTSW Abca1 R5022 G1 217 Y 4 53041570 TCGACTGC T frame shift Het probably null phenotype 06/06/2016
47 398917 UTSW Abca13 R5173 G1 217 Y 11 9682032 AC A frame shift Het probably null 07/06/2016
48 66431 UTSW Abca4 K7894 217 N 468 3 122147868 C CAA frame shift Het probably null phenotype 08/19/2013
49 235371 UTSW Abca6 R2164 G1 167 N 11 110210193 CTGTAGGAAATCTTCAATGT CTGT frame shift Het probably null 10/01/2014
50 246861 UTSW Abcb9 R2355 G1 217 N 5 124077305 CGG CG frame shift Het probably null 10/30/2014
51 247005 UTSW Abcb9 R2358 G1 202 Y 5 124077305 CGG CG frame shift Het probably null 10/30/2014
52 219837 UTSW Abcg5 R1970 G1 192 Y 17 84673602 AATCATTTG AG frame shift Het probably null phenotype 08/25/2014
54 67075 UTSW AC147806.1 R0707 G1 128 N 1 85577224 CAGAGAGA CAGAGAGAGA frame shift Het probably null 08/28/2013
55 78622 UTSW AC147806.1 R0819 G1 129 N 1 85577224 CAGAGAGA CAGAGAGAGA frame shift Het probably null 10/16/2013
56 94094 UTSW AC147806.1 R1053 G1 117 N 1 85577224 CAGAGAGA CAGAGAGAGA frame shift Het probably null 01/05/2014
57 101645 UTSW AC147806.1 R1155 G1 129 N 1 85577224 CAGAGAGA CAGAGAGAGA frame shift Het probably null 01/15/2014
58 152415 UTSW AC147806.1 R1236 G1 101 N 1 85577224 CAGAGAGA CAGAGAGAGA frame shift Het probably null 01/29/2014
59 152110 UTSW AC147806.1 R1245 G1 110 Y 1 85577224 CAGAGAGA CAGAGAGAGA frame shift Het probably null 01/29/2014
60 209014 UTSW AC147806.1 R1880 G1 153 N 1 85577224 CAGAGAGA CAGAGAGAGA frame shift Het probably null 06/30/2014
61 317893 UTSW AC147806.1 R1961 G1 121 Y 1 85577224 CAGAGAGA CAGAGAGAGA frame shift Het probably null 05/19/2015
62 221438 UTSW AC147806.1 R2033 G1 132 Y 1 85577154 CACAGA CA frame shift Het probably null 08/25/2014
63 226562 UTSW AC147806.1 R2055 G1 107 Y 1 85577224 CAGAGAGA CAGAGAGAGA frame shift Het probably null 09/17/2014
64 166141 UTSW AC225888.1 V5622 110 N 521 15 103754810 CA C frame shift Het unknown 04/07/2014
65 194791 UTSW Acaca R1755 G1 217 N 11 84276564 AC A frame shift Het probably null phenotype 05/23/2014
66 195712 UTSW Acacb R1783 G1 139 N 5 114209767 TGGGG TGGG frame shift Het probably null phenotype 05/23/2014
67 196019 UTSW Acacb R1784 G1 165 N 5 114209767 TGGGG TGGG frame shift Het probably null phenotype 05/23/2014
68 233377 UTSW Acacb R2132 G1 147 Y 5 114209767 TGGGG TGGG frame shift Het probably null phenotype 10/01/2014
69 233518 UTSW Acacb R2133 G1 143 N 5 114209767 TGGGG TGGG frame shift Het probably null phenotype 10/01/2014
70 402455 UTSW Acin1 R5223 G1 217 N 14 54642941 CCGC CC frame shift Het probably null 07/22/2016
71 428024 UTSW Actn3 R5420 G1 169 N 19 4865344 TGCGCAGC T frame shift Het probably null phenotype 09/01/2016
72 187972 UTSW Adamtsl2 R1675 G1 154 N 2 27082485 GC G frame shift Het probably null phenotype 05/09/2014
73 250464 UTSW Adgrv1 R2432 G1 217 Y 13 81540132 GA GAA frame shift Het probably null 11/12/2014
74 311320 UTSW Adgrv1 R4002 G1 217 Y 13 81540132 GA GAA frame shift Het probably null 04/29/2015
75 311360 UTSW Adgrv1 R4003 G1 217 Y 13 81540132 GA GAA frame shift Het probably null 04/29/2015
76 349294 UTSW Adora2b R4632 G1 217 N 11 62265382 TGGACCACTCCAGGACCACTC TGGACCACTC frame shift Het probably null phenotype 10/08/2015
77 274551 UTSW Aebp2 R3805 G1 217 Y 6 140643949 GCGGCC GCGGCCGGCC frame shift Het probably null phenotype 04/02/2015
78 65783 UTSW Aff2 R0190 G1 101 N X 69849105 CA CAAA frame shift Het probably null phenotype 08/19/2013
79 446281 UTSW AI429214 R5766 G1 217 N 8 36994229 TCCCTGATGAAC TC frame shift Het probably null 11/21/2016
80 446329 UTSW AI429214 R5767 G1 174 N 8 36994224 TACGATCCCTGA TA frame shift Het probably null 11/21/2016
81 446330 UTSW AI429214 R5767 G1 217 N 8 36994229 TCCCTGATGAAC TC frame shift Het probably null 11/21/2016
82 353690 UTSW Akap6 R4686 G1 217 Y 12 52887623 CA C frame shift Het probably null phenotype 10/21/2015
83 366647 UTSW Akap6 R4782 G1 217 N 12 52887623 CA C frame shift Het probably null phenotype 12/29/2015
85 197541 UTSW Amh R1195 G1 121 Y 10 80805585 AGCGCCTTGG AG frame shift Het probably null phenotype 05/23/2014
86 193424 UTSW Amh R1750 G1 122 N 10 80805585 AGCGCCTTGG AG frame shift Het probably null phenotype 05/23/2014
87 194304 UTSW Amh R1765 G1 107 Y 10 80805585 AGCGCCTTGG AG frame shift Het probably null phenotype 05/23/2014
88 224579 UTSW Amh R1998 G1 131 N 10 80805585 AGCGCCTTGG AG frame shift Het probably null phenotype 08/25/2014
89 459145 UTSW Amotl2 Z1088 217 N 9 102723698 TCC TC frame shift Het probably null 02/27/2017
90 343735 UTSW Ankle1 R4582 G1 217 N 8 71407207 AT A frame shift Het probably null 09/24/2015
91 345360 UTSW Ankle1 R4598 G1 217 N 8 71407207 AT A frame shift Het probably null 09/25/2015
92 345533 UTSW Ankle1 R4600 G1 217 N 8 71407207 AT A frame shift Het probably null 09/25/2015
93 345719 UTSW Ankle1 R4602 G1 217 N 8 71407207 AT A frame shift Het probably null 09/25/2015
94 344616 UTSW Ankle1 R4610 G1 217 Y 8 71407207 AT A frame shift Het probably null 09/25/2015
95 344723 UTSW Ankle1 R4611 G1 217 N 8 71407207 AT A frame shift Het probably null 09/25/2015
96 458327 UTSW Ankrd16 Z1088 217 N 2 11779818 CCTCCGGTACTT C frame shift Het probably null 02/27/2017
97 446097 UTSW Ankrd60 R5763 G1 217 N 2 173578089 TGGCCACGCGG TGG frame shift Het probably null 11/21/2016
98 447998 UTSW Ankrd60 R5786 G1 217 N 2 173578089 TGGCCACGCGG TGG frame shift Het probably null 12/15/2016
99 448064 UTSW Ankrd60 R5787 G1 217 N 2 173578089 TGGCCACGCGG TGG frame shift Het probably null 12/15/2016
100 448130 UTSW Ankrd60 R5788 G1 217 N 2 173578089 TGGCCACGCGG TGG frame shift Het probably null 12/15/2016
[records 1 to 100 of 1264] next >> last >|