Incidental Mutations

1,082 incidental mutations are currently displayed, and affect 387 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
0 are Probably Benign.
1,077 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 1082] next >> last >| per page Full List
ID question?
Source question?
Gene question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
MGI Phenotype question?
Posted question?
1 479988 UTSW 2310033P09Rik R6025 G1 217.47 N 11 59210313 GC G frame shift Het probably null 06/26/2017
2 437139 UTSW 3110002H16Rik R5574 G1 217 Y 18 12185006 CTGTGTGTT CTGTGTGTTGTGTGTT frame shift Het probably null 10/26/2016
3 56364 UTSW 4921517D22Rik R0579 G1 212 Y 13 59691598 GCC GC frame shift Het probably null 07/11/2013
4 61952 UTSW 4921517D22Rik R0664 G1 100 Y 13 59691598 GCC GC frame shift Het probably null 07/30/2013
5 69481 UTSW 4921517D22Rik R0757 G1 217 N 13 59691598 GCC GC frame shift Het probably null 09/30/2013
6 69488 UTSW 4921517D22Rik R0758 G1 217 N 13 59691598 GCC GC frame shift Het probably null 09/30/2013
7 76990 UTSW 4921517D22Rik R0777 G1 217 N 13 59691598 GCC GC frame shift Het probably null 10/16/2013
8 76569 UTSW 4921517D22Rik R0779 G1 217 N 13 59691598 GCC GC frame shift Het probably null 10/16/2013
9 78548 UTSW 4921517D22Rik R0814 G1 217 N 13 59691598 GCC GC frame shift Het probably null 10/16/2013
10 81632 UTSW 4921517D22Rik R0870 G1 217 N 13 59691598 GCC GC frame shift Het probably null 11/08/2013
11 81639 UTSW 4921517D22Rik R0872 G1 217 N 13 59691598 GCC GC frame shift Het probably null 11/08/2013
12 81644 UTSW 4921517D22Rik R0873 G1 217 N 13 59691598 GCC GC frame shift Het probably null 11/08/2013
13 100263 UTSW 4921517D22Rik R1062 G1 217 N 13 59691598 GCC GC frame shift Het probably null 01/15/2014
14 85947 UTSW 4921517D22Rik R1064 G1 217 N 13 59691598 GCC GC frame shift Het probably null 11/18/2013
15 165230 UTSW 4921517D22Rik R1149 G1 217 N 13 59691598 GCC GC frame shift Het probably null 03/28/2014
16 101604 UTSW 4921517D22Rik R1151 G1 217 N 13 59691598 GCC GC frame shift Het probably null 01/15/2014
17 101621 UTSW 4921517D22Rik R1152 G1 217 N 13 59691598 GCC GC frame shift Het probably null 01/15/2014
18 164807 UTSW 4921517D22Rik R1207 G1 217 N 13 59691598 GCC GC frame shift Het probably null 03/28/2014
19 150657 UTSW 4921517D22Rik R1285 G1 217 N 13 59691598 GCC GC frame shift Het probably null 01/29/2014
20 156968 UTSW 4921517D22Rik R1339 G1 217 N 13 59691598 GCC GC frame shift Het probably null 02/11/2014
21 156230 UTSW 4921517D22Rik R1358 G1 217 N 13 59691598 GCC GC frame shift Het probably null 02/11/2014
22 156371 UTSW 4921517D22Rik R1359 G1 217 N 13 59691598 GCC GC frame shift Het probably null 02/11/2014
23 156376 UTSW 4921517D22Rik R1360 G1 217 N 13 59691598 GCC GC frame shift Het probably null 02/11/2014
24 156378 UTSW 4921517D22Rik R1361 G1 217 N 13 59691598 GCCGACC GCGACC frame shift Het probably null 02/11/2014
25 188366 UTSW 4921517D22Rik R1679 G1 217 Y 13 59691598 GCC GC frame shift Het probably null 05/09/2014
26 206415 UTSW 4930544D05Rik E0370 G1 209 Y 11 70616426 TGCAGCGACTGGACGGCGGCA TGCA frame shift Het probably null phenotype 06/23/2014
27 262166 UTSW 4930556J24Rik T0975 G3 211 N 714 11 3937945 TAA TAAA frame shift Het probably null 02/04/2015
29 429653 UTSW A430005L14Rik R5396 G1 188 N 4 153960953 GCC G frame shift Het probably null 09/06/2016
30 216562 UTSW Abca1 R1945 G1 117 N 4 53061509 ACGTCTTCACCAGGTAATC AC frame shift Het probably null phenotype 08/01/2014
31 389233 UTSW Abca1 R5022 G1 217 Y 4 53041570 TCGACTGC T frame shift Het probably null phenotype 06/06/2016
32 398917 UTSW Abca13 R5173 G1 217 Y 11 9682032 AC A frame shift Het probably null 07/06/2016
33 66431 UTSW Abca4 K7894 217 N 468 3 122147868 C CAA frame shift Het probably null phenotype 08/19/2013
34 235371 UTSW Abca6 R2164 G1 167 N 11 110210193 CTGTAGGAAATCTTCAATGT CTGT frame shift Het probably null 10/01/2014
35 246861 UTSW Abcb9 R2355 G1 217 N 5 124077305 CGG CG frame shift Het probably null 10/30/2014
36 247005 UTSW Abcb9 R2358 G1 202 Y 5 124077305 CGG CG frame shift Het probably null 10/30/2014
37 219837 UTSW Abcg5 R1970 G1 192 Y 17 84673602 AATCATTTG AG frame shift Het probably null phenotype 08/25/2014
38 194791 UTSW Acaca R1755 G1 217 N 11 84276564 AC A frame shift Het probably null phenotype 05/23/2014
39 195712 UTSW Acacb R1783 G1 139 N 5 114209767 TGGGG TGGG frame shift Het probably null phenotype 05/23/2014
40 196019 UTSW Acacb R1784 G1 165 N 5 114209767 TGGGG TGGG frame shift Het probably null phenotype 05/23/2014
41 233377 UTSW Acacb R2132 G1 147 Y 5 114209767 TGGGG TGGG frame shift Het probably null phenotype 10/01/2014
42 233518 UTSW Acacb R2133 G1 143 N 5 114209767 TGGGG TGGG frame shift Het probably null phenotype 10/01/2014
43 402455 UTSW Acin1 R5223 G1 217 N 14 54642941 CCGC CC frame shift Het probably null 07/22/2016
44 428024 UTSW Actn3 R5420 G1 169 Y 19 4865344 TGCGCAGC T frame shift Het probably null phenotype 09/01/2016
45 187972 UTSW Adamtsl2 R1675 G1 154 N 2 27082485 GC G frame shift Het probably null phenotype 05/09/2014
46 250464 UTSW Adgrv1 R2432 G1 217 Y 13 81540132 GA GAA frame shift Het probably null phenotype 11/12/2014
47 311320 UTSW Adgrv1 R4002 G1 217 Y 13 81540132 GA GAA frame shift Het probably null phenotype 04/29/2015
48 311360 UTSW Adgrv1 R4003 G1 217 Y 13 81540132 GA GAA frame shift Het probably null phenotype 04/29/2015
49 349294 UTSW Adora2b R4632 G1 217 N 11 62265382 TGGACCACTCCAGGACCACTC TGGACCACTC frame shift Het probably null phenotype 10/08/2015
50 274551 UTSW Aebp2 R3805 G1 217 Y 6 140643949 GCGGCC GCGGCCGGCC frame shift Het probably null phenotype 04/02/2015
51 65783 UTSW Aff2 R0190 G1 101 N X 69849105 CA CAAA frame shift Het probably null phenotype 08/19/2013
52 225965 UTSW Agtpbp1 R2001 G1 217 N 13 59475803 TGAAGATGCATCTTGAGAAGA TGAAGA frame shift Het probably null phenotype 08/25/2014
53 446281 UTSW AI429214 R5766 G1 217 N 8 36994229 TCCCTGATGAAC TC frame shift Het probably null 11/21/2016
54 446330 UTSW AI429214 R5767 G1 217 Y 8 36994229 TCCCTGATGAAC TC frame shift Het probably null 11/21/2016
55 392332 UTSW Aim1l R4680 G1 201 Y 4 134072718 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA frame shift Het probably null 06/15/2016
56 406132 UTSW Aim1l R4681 G1 205 Y 4 134072718 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA frame shift Het probably null 07/28/2016
57 397267 UTSW Aim1l R4682 G1 217 Y 4 134072718 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA frame shift Het probably null 07/05/2016
58 353690 UTSW Akap6 R4686 G1 217 Y 12 52887623 CA C frame shift Het probably null phenotype 10/21/2015
59 366647 UTSW Akap6 R4782 G1 217 N 12 52887623 CA C frame shift Het probably null phenotype 12/29/2015
60 231826 UTSW Alb R2092 G1 217 N 5 90463983 G GA frame shift Het probably null phenotype 09/18/2014
61 500181 UTSW Amh R1195 G1 121 N 10 80805585 AGCGCCTTGG AG frame shift Het probably null phenotype 12/01/2017
62 193424 UTSW Amh R1750 G1 122 N 10 80805585 AGCGCCTTGG AG frame shift Het probably null phenotype 05/23/2014
63 194304 UTSW Amh R1765 G1 107 Y 10 80805585 AGCGCCTTGG AG frame shift Het probably null phenotype 05/23/2014
64 224579 UTSW Amh R1998 G1 131 N 10 80805585 AGCGCCTTGG AG frame shift Het probably null phenotype 08/25/2014
65 459145 UTSW Amotl2 Z1088 217 N 9 102723698 TCC TC frame shift Het probably null 02/27/2017
66 458327 UTSW Ankrd16 Z1088 217 N 2 11779818 CCTCCGGTACTT C frame shift Het probably null 02/27/2017
67 446097 UTSW Ankrd60 R5763 G1 217 Y 2 173578089 TGGCCACGCGG TGG frame shift Het probably null 11/21/2016
68 447998 UTSW Ankrd60 R5786 G1 217 N 2 173578089 TGGCCACGCGG TGG frame shift Het probably null 12/15/2016
69 448064 UTSW Ankrd60 R5787 G1 217 N 2 173578089 TGGCCACGCGG TGG frame shift Het probably null 12/15/2016
70 448130 UTSW Ankrd60 R5788 G1 217 Y 2 173578089 TGGCCACGCGG TGG frame shift Het probably null 12/15/2016
71 164312 UTSW Anxa2 R1480 G1 217 N 9 69489754 TCCC TCC frame shift Het probably null phenotype 03/28/2014
72 164452 UTSW Anxa2 R1482 G1 178 N 9 69489754 TCCC TCC frame shift Het probably null phenotype 03/28/2014
73 176680 UTSW Anxa2 R1609 G1 152 Y 9 69489754 TCCC TCC frame shift Het probably null phenotype 04/24/2014
74 176743 UTSW Anxa2 R1610 G1 217 N 9 69489754 TCCC TCC frame shift Het probably null phenotype 04/24/2014
75 187712 UTSW Anxa2 R1672 G1 217 N 9 69489754 TCCC TCC frame shift Het probably null phenotype 05/09/2014
76 192244 UTSW Anxa2 R1696 G1 158 N 9 69489754 TCCC TCC frame shift Het probably null phenotype 05/14/2014
77 209357 UTSW Anxa2 R1884 G1 217 Y 9 69489754 TCCC TCC frame shift Het probably null phenotype 06/30/2014
78 233843 UTSW Anxa2 R2146 G1 102 Y 9 69489754 TCCC TCC frame shift Het probably null phenotype 10/01/2014
79 234024 UTSW Anxa2 R2148 G1 217 N 9 69489754 TCCC TCC frame shift Het probably null phenotype 10/01/2014
80 234120 UTSW Anxa2 R2149 G1 174 N 9 69489754 TCCC TCC frame shift Het probably null phenotype 10/01/2014
81 234203 UTSW Anxa2 R2150 G1 212 Y 9 69489754 TCCC TCC frame shift Het probably null phenotype 10/01/2014
82 366988 UTSW Ap3d1 R4785 G1 106 N 10 80712778 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT frame shift Het probably null phenotype 12/29/2015
83 374763 UTSW Ap3d1 R4864 G1 103 Y 10 80712778 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT frame shift Het probably null phenotype 03/17/2016
84 276418 UTSW Arfgef1 R3863 G1 217 N 1 10142586 CAGAG CAG frame shift Het probably null 04/06/2015
85 307772 UTSW Arfgef1 R3948 G1 217 Y 1 10142586 CAGAG CAG frame shift Het probably null 04/17/2015
86 307804 UTSW Arfgef1 R3949 G1 217 Y 1 10142586 CAGAG CAG frame shift Het probably null 04/17/2015
87 56402 UTSW Arhgap23 R0580 G1 107 Y 11 97446536 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG frame shift Het probably null 07/11/2013
88 480795 UTSW Arhgap44 R6000 G1 217.47 N 11 65032084 CTGCT CTGCTTGCT frame shift Het probably null 06/26/2017
89 480843 UTSW Arhgap44 R6001 G1 217.47 N 11 65032084 CTGCT CTGCTTGCT frame shift Het probably null 06/26/2017
90 483311 UTSW Arhgap44 R6046 G1 217.47 N 11 65032084 CTGCT CTGCTTGCT frame shift Het probably null 07/14/2017
91 484048 UTSW Arhgap44 R6066 G1 217.47 N 11 65032084 CTGCT CTGCTTGCT frame shift Het probably null 07/14/2017
92 394648 UTSW Atp10a R5051 G1 217 Y 7 58740246 TGTCCGTC TGTC frame shift Het probably null phenotype 06/15/2016
93 273598 UTSW Atp2b1 R3776 G1 101 N 10 98979869 CTTTTT CTTTTTT frame shift Het probably null phenotype 03/25/2015
94 265916 UTSW Atp8a2 R3029 G1 188 N 14 59691465 CGT CGTGT frame shift Het probably null phenotype 02/05/2015
95 264419 UTSW B230217C12Rik R3151 G1 217 Y 11 97842188 TGTGTCG TG frame shift Het probably null 02/05/2015
96 345907 UTSW B3gnt2 R4604 G1 217 N 11 22836426 T TTCACAAA frame shift Het probably null phenotype 09/25/2015
99 489408 UTSW B430203G13Rik R6153 G1 129.47 N 12 17924386 CTTT CTTTTTTT frame shift Het probably null 10/10/2017
100 238492 UTSW Bag3 R2198 G1 217 Y 7 128545769 AAAGG AAAGGAAGG frame shift Het probably null phenotype 10/02/2014
[records 1 to 100 of 1082] next >> last >|