Incidental Mutations

3,588 incidental mutations are currently displayed, and affect 2,557 genes.
13 are Possibly Damaging.
15 are Probably Damaging.
2,361 are Probably Benign.
1,177 are Probably Null.
13 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 3588] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 531109 UTSW 0610010F05Rik 0.192 R6758 G1 97.01 N 11 23588475 T C intron 160 bp Het probably null 08/01/2018
2 462477 UTSW 0610037L13Rik 0.223 R5940 G1 225 Y 4 107893288 A G intron Het probably benign 0.064 02/28/2017
3 401247 UTSW 1110032A03Rik 0.000 R5258 G1 150 Y 9 50764333 T C intron Het probably benign 07/06/2016
4 397644 UTSW 1110059E24Rik 0.090 R5182 G1 225 Y 19 21630765 M1T A G intron Het probably null 0.595 07/06/2016
5 457914 UTSW 1520401A03Rik 0.115 R5459 G1 225 N 17 23711843 C T intron Het probably benign 02/16/2017
6 266055 UTSW 1700001O22Rik 0.022 R2082 G1 225 N 2 30796379 T A intron 22 bp Het probably null 02/05/2015
7 478174 UTSW 1700007G11Rik 0.154 LCD18 G1 999 Y 5 98707508 G A intron Het probably benign 05/26/2017
8 81249 UTSW 1700007G11Rik 0.154 R0962 G1 225 Y 5 98566561 T C intron Het probably benign 11/07/2013
9 217552 UTSW 1700007G11Rik 0.154 R1954 G1 225 Y 5 98566753 A T intron Het probably benign 08/01/2014
10 266065 UTSW 1700013D24Rik 0.097 R2146 G1 225 N 6 124347844 A T intron Het probably null 02/05/2015
11 422361 UTSW 1700017D01Rik 0.068 R5341 G1 225 Y 19 11110381 T C intron Het probably benign 08/04/2016
12 356358 UTSW 1700028I16Rik 0.229 R3836 G1 145 Y 10 82812385 A G intron Het noncoding transcript 11/06/2015
13 359749 UTSW 1700028I16Rik 0.229 R3837 G1 204 Y 10 82812385 A G intron Het noncoding transcript 12/16/2015
14 359664 UTSW 1700028I16Rik 0.229 R3839 G1 225 Y 10 82812385 A G intron Het noncoding transcript 11/12/2015
15 539519 UTSW 1700086D15Rik 0.117 R6919 G1 225.01 N 11 65152530 L141P A G intron Het probably benign 11/06/2018
16 324948 UTSW 2200002D01Rik 0.085 R4362 G1 225 Y 7 29248262 C T intron Het probably benign 07/06/2015
17 344974 UTSW 2210408I21Rik 0.359 R4614 G1 225 Y 13 77254256 T G intron 39 bp Het probably null 0.624 09/25/2015
18 271571 UTSW 2310033P09Rik 0.335 R1476 G1 167 Y 11 59208702 A G intron Het probably benign 0.057 03/23/2015
19 428240 UTSW 2310035C23Rik 0.473 R5435 G1 120 Y 1 105741250 T A intron Het probably benign 09/01/2016
20 451567 UTSW 2310035C23Rik 0.473 R5734 G1 225 Y 1 105703883 T C intron Het probably benign 0.018 01/03/2017
21 352707 UTSW 2410089E03Rik 1.000 R4659 G1 225 Y 15 8216276 G T intron Het probably benign 0.064 phenotype 10/08/2015
22 157148 UTSW 2610507B11Rik 0.960 R0244 G1 105 N 11 78286491 T A intron Het probably null 02/14/2014
23 368375 UTSW 2610507B11Rik 0.960 R4196 G1 225 Y 11 78263556 A G intron Het probably benign 02/02/2016
24 324392 UTSW 2700081O15Rik 0.277 R4326 G1 197 Y 19 7421226 A G intron Het probably benign 0.068 06/24/2015
25 397274 UTSW 2700081O15Rik 0.277 R4329 G1 74 Y 19 7421226 A G intron Het probably benign 0.068 07/05/2016
26 453396 UTSW 2900041M22Rik 0.225 IGL03055 G1 106 Y 11 117612246 T A intron Het noncoding transcript 0.061 02/03/2017
27 374169 UTSW 3110002H16Rik 0.665 R4826 G1 210 Y 18 12185779 G T intron Het probably benign 0.050 phenotype 03/01/2016
28 430948 UTSW 3110002H16Rik 0.665 R5506 G1 225 Y 18 12188956 A G intron Het probably benign 0.064 phenotype 10/05/2016
29 181470 APN 4732465J04Rik 0.261 IGL01958 G1 10 95793797 I29T T C intron Het probably damaging 0.985 05/07/2014
30 65757 UTSW 4732465J04Rik 0.261 R0080 G1 133 Y 10 95794578 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC intron Het probably null 08/19/2013
31 65771 UTSW 4732465J04Rik 0.261 R0164 G1 161 Y 10 95794578 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC intron Het probably null 08/19/2013
32 191138 UTSW 4732465J04Rik 0.261 R1717 G1 148 Y 10 95793779 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT intron Het probably null 05/14/2014
33 383829 UTSW 4833420G17Rik 0.197 R4964 G1 225 Y 13 119474221 T C intron Het probably benign 0.062 04/27/2016
34 384042 UTSW 4833420G17Rik 0.197 R4966 G1 225 Y 13 119474221 T C intron Het probably benign 0.062 04/27/2016
35 387950 UTSW 4833420G17Rik 0.197 R5093 G1 225 Y 13 119474037 C T intron Het probably benign 06/06/2016
36 384139 UTSW 4930447C04Rik 0.326 R4967 G1 225 Y 12 72909728 Y199* A T intron Het probably null 0.613 phenotype 04/27/2016
37 535655 UTSW 4930503L19Rik 0.116 R6381 G1 220.01 Y 18 70467717 M365L T A intron Het probably damaging 1.000 10/01/2018
38 529349 UTSW 4930511M06Rik PIT1430001 G1 100 Y 18 57384169 T C intron Het probably benign 07/31/2018
39 359705 UTSW 4930544M13Rik 0.306 R4036 G1 225 Y 13 114607669 T C intron Het noncoding transcript 0.040 12/02/2015
40 265937 UTSW 4931422A03Rik 0.160 R1722 G1 225 N 2 103993928 A T intron Het probably null 02/05/2015
41 368379 UTSW 4932414N04Rik 0.083 R4153 G1 66 Y 2 68668597 A T intron Het probably benign 02/03/2016
42 348502 UTSW 4932438A13Rik 0.921 R4672 G1 225 Y 3 36889990 *330W A G intron Het probably null 0.647 phenotype 10/08/2015
43 453345 UTSW 4932438A13Rik 0.921 R5030 G1 225 Y 3 36943399 A G intron Het probably benign 0.065 phenotype 02/01/2017
44 394507 UTSW 4932438A13Rik 0.921 R5049 G1 225 Y 3 37040506 T A intron Het probably benign 0.063 phenotype 06/15/2016
45 358160 UTSW 4933407L21Rik 0.078 R4743 G1 131 Y 1 85931251 A G intron Het probably benign 0.055 11/11/2015
46 532555 UTSW 9230113P08Rik 0.136 R6790 G1 225.01 N 9 35908831 G T intron Het probably benign 08/29/2018
47 376865 UTSW 9530053A07Rik 0.112 R4876 G1 225 Y 7 28142800 A T intron Het probably benign 03/17/2016
48 438082 UTSW 9530053A07Rik 0.112 R5613 G1 225 Y 7 28142878 A T intron Het probably benign 10/26/2016
49 484581 UTSW 9530077C05Rik 0.178 LCD18 G1 2735.94 Y 9 22442083 N intron Het probably benign 0.052 08/15/2017
50 404600 UTSW 9930021J03Rik 0.281 R5306 G1 225 Y 19 29729830 A G intron Het probably benign 0.615 07/22/2016
51 490322 UTSW 9930111J21Rik2 0.289 R6169 G1 225.01 N 11 49019261 S782T A T intron 40271 bp Het probably null 10/10/2017
52 532970 UTSW A2m 0.000 R6795 G1 138.01 N 6 121648322 T A intron 146 bp Het probably null phenotype 08/29/2018
53 531229 UTSW A2ml1 0.263 R6327 G1 129.01 Y 6 128558692 T C intron Het probably null 08/07/2018
54 478194 UTSW A330008L17Rik 0.085 LCD18 G1 999 Y 8 99723425 A G intron Het noncoding transcript 05/26/2017
55 351344 UTSW A830018L16Rik 0.137 R4652 G1 182 Y 1 11537342 C A intron Het probably benign phenotype 10/08/2015
56 533543 UTSW A930009A15Rik 0.075 R6805 G1 225.01 N 10 115579905 R109L G T intron Het probably benign 09/12/2018
57 343283 UTSW A930011G23Rik 0.158 R4565 G1 225 Y 5 99227947 T C intron Het probably benign 09/24/2015
58 424834 UTSW Aadac 0.104 R5383 G1 219 Y 3 60036075 T C intron Het probably benign phenotype 08/04/2016
59 478219 UTSW Aaed1 0.137 LCD18 G1 119 Y 13 64287285 G A intron Het probably benign 05/26/2017
60 314437 UTSW Aamp 0.968 R4112 G1 225 Y 1 74281227 A G intron Het probably benign 0.071 phenotype 05/14/2015
61 265992 UTSW Aarsd1 0.378 R1909 G1 225 N 11 101410231 A C intron Het probably null 02/05/2015
62 518336 UTSW Abat 0.130 R6426 G1 225.01 Y 16 8602436 H200Y C T intron Het probably benign phenotype 05/24/2018
63 518377 UTSW Abat 0.130 R6427 G1 225.01 Y 16 8602436 H200Y C T intron Het probably benign phenotype 05/24/2018
64 516245 UTSW Abca4 0.000 R6405 G1 198.01 N 3 122173662 A G intron Het probably null phenotype 05/04/2018
65 530570 UTSW Abca4 0.000 R6747 G1 216.01 N 3 122126313 C T intron 53 bp Het probably null phenotype 08/01/2018
66 388339 UTSW Abca5 0.172 R5066 G1 225 Y 11 110309350 A T intron Het probably benign 0.136 phenotype 06/06/2016
67 224814 UTSW Abca8a 0.084 R2037 G1 225 N 11 110089984 M76K A T intron Het probably null 08/25/2014
68 261870 UTSW Abca8b 0.350 R0226 G1 137 N 11 109957018 T C intron 45 bp Het probably null phenotype 02/04/2015
69 435717 UTSW Abcb1a 0.216 R5572 G1 212 Y 5 8715108 C T intron 45 bp Het probably null 0.627 phenotype 10/24/2016
70 389235 UTSW Abcb4 0.000 R5022 G1 225 Y 5 8909054 T A intron Het probably null 0.648 phenotype 06/06/2016
71 384036 UTSW Abcb5 0.296 R4966 G1 225 Y 12 118886891 T A intron Het probably benign 0.057 phenotype 04/27/2016
72 349323 UTSW Abcb6 0.739 R4633 G1 225 Y 1 75177782 A T intron Het probably benign phenotype 10/08/2015
73 445287 UTSW Abcb8 0.208 R5761 G1 225 Y 5 24405881 T C intron Het probably benign 0.062 phenotype 11/21/2016
74 328670 UTSW Abcc5 0.000 R4432 G1 225 Y 16 20368187 A T intron Het probably null 0.620 phenotype 07/21/2015
75 328716 UTSW Abcc5 0.000 R4433 G1 225 Y 16 20368187 A T intron Het probably null 0.620 phenotype 07/21/2015
76 386559 UTSW Abcc9 0.276 R5060 G1 225 Y 6 142626110 A G intron Het probably benign phenotype 06/06/2016
77 442169 UTSW Abcc9 0.276 R5654 G1 225 Y 6 142625645 G A intron Het probably benign 0.062 phenotype 11/09/2016
78 451584 UTSW Abcc9 0.276 R5734 G1 225 Y 6 142625731 A G intron Het probably benign phenotype 01/03/2017
79 354566 UTSW Abcf1 0.883 R4722 G1 225 Y 17 35958041 T C intron Het probably benign 0.062 phenotype 10/21/2015
80 394930 UTSW Abcf1 0.883 R5129 G1 225 Y 17 35960795 C T intron Het probably benign phenotype 06/21/2016
81 399538 UTSW Abcf1 0.883 R5255 G1 225 N 17 35959737 A T intron Het probably null phenotype 07/06/2016
82 431553 UTSW Abcg4 0.276 R5521 G1 223 Y 9 44279683 A G intron Het probably benign phenotype 10/05/2016
83 245220 UTSW Abhd12 0.386 R2298 G1 225 N 2 150901494 C A intron Het probably benign phenotype 10/30/2014
84 457560 UTSW Abhd16a 0.464 R5896 G1 225 Y 17 35091725 T A intron Het probably benign phenotype 02/15/2017
85 435423 UTSW Abi2 0.000 R5557 G1 225 Y 1 60438912 C A intron Het probably benign phenotype 10/24/2016
86 98872 UTSW Abi3bp 0.163 R0485 G1 106 Y 16 56604012 A G intron Het probably null 0.637 01/10/2014
87 427247 UTSW Ablim3 0.270 R5442 G1 225 N 18 61857225 A T intron Het probably null phenotype 09/01/2016
88 481516 UTSW Abraxas1 0.239 R5983 G1 219.01 Y 5 100807911 V237A A G intron Het probably benign 0.000 phenotype 06/26/2017
89 249996 UTSW Acad11 0.291 R2411 G1 225 Y 9 104086023 T G intron Het probably benign 0.090 phenotype 11/12/2014
90 308108 UTSW Acad11 0.291 R3954 G1 225 Y 9 104086152 A G intron Het probably benign 0.070 phenotype 04/17/2015
91 310706 UTSW Acad11 0.291 R3956 G1 225 Y 9 104086152 A G intron Het probably benign 0.070 phenotype 04/29/2015
92 376665 UTSW Acad11 0.291 R4872 G1 225 Y 9 104086266 G A intron Het probably benign 0.102 phenotype 03/17/2016
93 471166 UTSW Acad9 0.869 R5956 G1 225 Y 3 36075174 A G intron Het probably benign 0.057 phenotype 03/31/2017
94 454869 UTSW Acadsb 0.149 R5855 G1 225 N 7 131424599 L57R T G intron Het probably null phenotype 02/10/2017
95 343155 UTSW Acap1 0.000 R4562 G1 225 Y 11 69885351 C T intron Het probably benign 09/24/2015
96 371198 UTSW Acap3 0.339 R4822 G1 81 Y 4 155902451 T A intron Het probably benign 0.102 03/01/2016
97 440033 UTSW Acat1 0.367 R5634 G1 225 Y 9 53583621 T C intron Het probably benign 0.058 phenotype 11/08/2016
98 262746 UTSW Acbd4 0.642 R1263 G1 205 N 11 103103851 T A intron Het probably null phenotype 02/04/2015
99 331984 UTSW Acbd4 0.642 R4505 G1 225 Y 11 103104779 A G intron Het probably benign phenotype 07/21/2015
100 261941 UTSW Acd 0.480 R0613 G1 225 N 8 105700568 A T intron Het probably null phenotype 02/04/2015
[records 1 to 100 of 3588] next >> last >|