Incidental Mutations

1,075 incidental mutations are currently displayed, and affect 913 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
65 are Probably Benign.
950 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 1075] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
MGI Phenotype question?
Posted question?
 
1 457914 UTSW 1520401A03Rik R5459 G1 225 N 17 23711843 C T intron Het probably null 02/16/2017
2 266055 UTSW 1700001O22Rik R2082 G1 225 N 2 30796379 T A intron Het probably null 02/05/2015
3 266065 UTSW 1700013D24Rik R2146 G1 225 N 6 124347844 A T intron Het probably null 02/05/2015
4 456108 UTSW 1700023F06Rik R5886 G1 225 N 11 103208121 A G intron Het probably null 02/15/2017
5 356358 UTSW 1700028I16Rik R3836 G1 145 Y 10 82812385 A G intron Het 11/06/2015
6 359749 UTSW 1700028I16Rik R3837 G1 204 Y 10 82812385 A G intron Het 12/16/2015
7 359664 UTSW 1700028I16Rik R3839 G1 225 Y 10 82812385 A G intron Het 11/12/2015
8 266087 UTSW 1700084C06Rik R2137 G1 225 N 9 21110985 A G intron Het probably null 02/05/2015
9 265955 UTSW 1700112D23Rik R1755 G1 225 N 3 28713662 T A intron Het probably null 02/05/2015
10 461651 UTSW 1810062O18Rik R5922 G1 225 N 14 20552071 T C intron Het probably null 02/28/2017
11 344974 UTSW 2210408I21Rik R4614 G1 225 Y 13 77254256 T G intron Het probably null 09/25/2015
12 157148 UTSW 2610507B11Rik R0244 G1 105 N 11 78286491 T A intron Het probably null 02/14/2014
13 453396 UTSW 2900041M22Rik IGL03055 G1 106 Y 11 117612246 T A intron Het 02/03/2017
14 191138 UTSW 4732465J04Rik R1717 G1 148 Y 10 95793779 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT intron Homo probably null 05/14/2014
15 266123 UTSW 4833403I15Rik R2371 G1 225 N 18 46878163 T G intron Het probably null 02/05/2015
16 390857 UTSW 4930483K19Rik R5056 G1 225 Y 10 76552926 T G intron Het probably null 06/06/2016
17 431051 UTSW 4930511M06Rik R5508 G1 225 N 18 57538084 G A intron Het probably null 10/05/2016
18 431108 UTSW 4930511M06Rik R5509 G1 225 N 18 57538084 G A intron Het probably null 10/05/2016
19 431192 UTSW 4930511M06Rik R5510 G1 225 N 18 57538084 G A intron Het probably null 10/05/2016
20 431259 UTSW 4930511M06Rik R5511 G1 225 N 18 57538084 G A intron Het probably null 10/05/2016
21 261993 UTSW 4930516K23Rik R0650 G1 165 N 7 104003239 A G intron Het probably null 02/04/2015
22 261994 UTSW 4930516K23Rik R0652 G1 99 N 7 104003239 A G intron Het probably null 02/04/2015
23 404351 UTSW 4930516K23Rik R5303 G1 225 N 7 104069032 T C intron Het probably null 07/22/2016
24 359705 UTSW 4930544M13Rik R4036 G1 225 Y 13 114607669 T C intron Het 12/02/2015
25 265937 UTSW 4931422A03Rik R1722 G1 225 N 2 103993928 A T intron Het probably null 02/05/2015
26 453345 UTSW 4932438A13Rik R5030 G1 225 Y 3 36943399 A G intron Het 02/01/2017
27 382268 UTSW 5330439B14Rik R4960 G1 225 N 6 142620783 A T intron Het probably null 04/27/2016
28 321001 UTSW 6330549D23Rik R4234 G1 225 N 3 96623657 T A intron Het probably null 06/12/2015
29 433396 UTSW 8030451A03Rik R5469 G1 225 N 4 64013925 T C intron Het probably null 10/06/2016
30 435329 UTSW 9330182L06Rik R5555 G1 225 N 5 9422296 T A intron Het probably null 10/24/2016
31 444306 UTSW 9430060I03Rik R5665 G1 225 N 1 92937931 T A intron Het probably null 11/09/2016
32 256359 UTSW A630014C17Rik R2937 G1 225 Y 11 52282783 A T intron Het probably null 12/31/2014
33 256987 UTSW A630014C17Rik R2938 G1 225 Y 11 52282783 A T intron Het probably null 12/31/2014
34 265992 UTSW Aarsd1 R1909 G1 225 N 11 101410231 A C intron Het probably null 02/05/2015
35 261870 UTSW Abca8b R0226 G1 137 N 11 109957018 T C intron Het probably null 02/04/2015
36 435717 UTSW Abcb1a R5572 G1 212 N 5 8715108 C T intron Het probably null phenotype 10/24/2016
37 389235 UTSW Abcb4 R5022 G1 225 Y 5 8909054 T A intron Het probably null phenotype 06/06/2016
38 275363 UTSW Abcb5 R3825 G1 225 Y 12 118901352 C T intron Het probably null 04/02/2015
39 328670 UTSW Abcc5 R4432 G1 225 Y 16 20368187 A T intron Het probably null phenotype 07/21/2015
40 328716 UTSW Abcc5 R4433 G1 225 Y 16 20368187 A T intron Het probably null phenotype 07/21/2015
41 399538 UTSW Abcf1 R5255 G1 225 N 17 35959737 A T intron Het probably null 07/06/2016
42 370006 UTSW Abhd5 R4818 G1 204 Y 9 122363800 T A intron Het probably null phenotype 02/04/2016
43 448027 UTSW Abhd5 R5786 G1 225 N 9 122363803 A G intron Het probably null phenotype 12/15/2016
44 98872 UTSW Abi3bp R0485 G1 106 Y 16 56604012 A G intron Het probably null 01/10/2014
45 427247 UTSW Ablim3 R5442 G1 225 N 18 61857225 A T intron Het probably null 09/01/2016
46 226092 UTSW Abpd R1930 G1 225 N 7 33366196 T C intron Het probably null 09/11/2014
47 266036 UTSW Abtb1 R2050 G1 109 N 6 88840806 G A intron Het probably null 02/05/2015
48 261819 UTSW AC132131.1 R0312 G1 225 N 10 90512914 A G intron Het probably null 02/04/2015
49 98973 UTSW AC138665.1 R0662 G1 192 N 3 59606743 A T intron Het probably null 01/10/2014
50 262746 UTSW Acbd4 R1263 G1 205 N 11 103103851 T A intron Het probably null 02/04/2015
51 330388 UTSW Accsl R4472 G1 225 Y 2 93863992 G T intron Het probably null 07/21/2015
52 261941 UTSW Acd R0613 G1 225 N 8 105700568 A T intron Het probably null phenotype 02/04/2015
53 437186 UTSW Acin1 R5575 G1 165 N 14 54678738 C T intron Het probably null 10/26/2016
54 437716 UTSW Acly R5594 G1 225 N 11 100522120 T C intron Het probably null phenotype 10/26/2016
55 262056 UTSW Acpp R0098 G1 83 N 9 104319945 C T intron Het probably null phenotype 02/04/2015
56 201350 UTSW Acsl1 R0019 G1 67 Y 8 46521250 T A intron Het probably null phenotype 06/02/2014
57 450111 UTSW Acss2 R5825 G1 225 N 2 155549178 T A intron Het probably null 12/20/2016
58 271579 UTSW Acta2 R1597 G1 211 Y 19 34252583 A T intron Het unknown phenotype 03/23/2015
59 266073 UTSW Adam19 R2092 G1 225 N 11 46060904 T G intron Het probably null phenotype 02/05/2015
60 374914 UTSW Adam5 R4866 G1 225 Y 8 24742156 A C intron Het probably null 03/17/2016
61 376089 UTSW Adam5 R4900 G1 217 Y 8 24742156 A C intron Het probably null 03/17/2016
62 261914 UTSW Adamts18 R0514 G1 132 N 8 113738769 C T intron Het probably null phenotype 02/04/2015
63 325103 UTSW Adamts18 R4376 G1 225 N 8 113773240 A T intron Het probably null phenotype 07/06/2015
64 447798 UTSW Adamtsl3 R5782 G1 225 N 7 82540286 T A intron Het probably null phenotype 12/15/2016
65 346170 UTSW Adap2os R4621 G1 225 Y 11 80174073 T A intron Het probably null 09/25/2015
66 271603 UTSW Adat1 R1972 G1 170 Y 8 111990418 A G intron Het unknown 03/23/2015
67 313258 UTSW Adcy4 R4021 G1 225 Y 14 55775178 C T intron Het probably null phenotype 04/30/2015
68 313318 UTSW Adcy4 R4022 G1 225 Y 14 55775178 C T intron Het probably null phenotype 04/30/2015
69 266204 UTSW Add3 R2926 G1 141 N 19 53226822 A G intron Het probably null phenotype 02/05/2015
70 470925 UTSW Add3 R5951 G1 225 N 19 53244289 A G intron Het probably null phenotype 03/31/2017
71 402578 UTSW Adgrb1 R5225 G1 201 Y 15 74577499 T A intron Het probably null 07/22/2016
72 261901 UTSW AI118078 R0497 G1 171 N 9 55380884 C T intron Het probably null 02/04/2015
73 266077 UTSW Akp3 R2111 G1 225 N 1 87126885 A T intron Het probably null phenotype 02/05/2015
74 262024 UTSW Akr1c13 R0722 G1 218 N 13 4197932 A G intron Het probably null 02/04/2015
75 310550 UTSW Alas1 R3896 G1 225 Y 9 106241801 G T intron Het probably null phenotype 04/17/2015
76 317620 UTSW Alas1 R4091 G1 225 Y 9 106241801 G T intron Het probably null phenotype 05/15/2015
77 317744 UTSW Alas1 R4093 G1 225 Y 9 106241801 G T intron Het probably null phenotype 05/15/2015
78 317863 UTSW Alas1 R4095 G1 225 Y 9 106241801 G T intron Het probably null phenotype 05/15/2015
79 269024 UTSW Aldh7a1 R3552 G1 127 Y 18 56550292 T C intron Het probably null phenotype 02/19/2015
80 343365 UTSW Alg12 R4567 G1 225 Y 15 88806353 T C intron Het probably null 09/24/2015
81 398108 UTSW Alms1 R5233 G1 225 Y 6 85656371 T A intron Het probably null phenotype 07/06/2016
82 266011 UTSW Amdhd2 R1929 G1 186 N 17 24157886 T C intron Het probably null 02/05/2015
83 325792 UTSW Ank2 R4367 G1 225 Y 3 126946149 T C intron Het not run phenotype 07/06/2015
84 386547 UTSW Ank2 R5060 G1 225 Y 3 126945921 T C intron Het not run phenotype 06/06/2016
85 395192 UTSW Ank2 R5148 G1 212 Y 3 127025636 A T intron Het probably null phenotype 06/21/2016
86 380657 UTSW Ank3 R4932 G1 225 N 10 69898223 T A intron Het probably null phenotype 04/15/2016
87 95578 UTSW Ankar R1121 G1 225 N 1 72651663 G A intron Het probably null 01/05/2014
88 266187 UTSW Ankhd1 R2519 G1 225 N 18 36578543 T G intron Het probably null 02/05/2015
89 405773 UTSW Ankhd1 R5314 G1 225 N 18 36561058 A T intron Het probably null 07/22/2016
90 376490 UTSW Ankle2 R4870 G1 225 Y 5 110251478 T A intron Het probably null 03/17/2016
91 320566 UTSW Ankrd35 R4166 G1 225 Y 3 96679155 T A intron Het probably null 06/12/2015
92 307410 UTSW Ankrd42 R3940 G1 225 Y 7 92591788 T C intron Het probably null 04/17/2015
93 471729 UTSW Anks1 R5975 G1 225 N 17 27991447 T A intron Het probably null phenotype 03/31/2017
94 457740 UTSW Anks1b R5899 G1 225 N 10 90923517 T A intron Het probably null 02/15/2017
95 266021 UTSW Anpep R1985 G1 225 N 7 79840857 A C intron Het probably null phenotype 02/05/2015
96 256227 UTSW Anxa13 R2916 G1 225 N 15 58345080 T C intron Het probably null 12/31/2014
97 261868 UTSW Anxa6 R0220 G1 225 N 11 54981762 A C intron Het probably null phenotype 02/04/2015
98 261733 UTSW Aoah R1662 G1 225 N 13 21000113 A G intron Het probably null phenotype 01/28/2015
99 473884 UTSW Ap1b1 R3805 G1 225 N 11 5033225 T A intron Het probably null 04/14/2017
100 431170 UTSW Ap2b1 R5510 G1 216 N 11 83336737 A G intron Het probably null phenotype 10/05/2016
[records 1 to 100 of 1075] next >> last >|