Incidental Mutations

1,235 incidental mutations are currently displayed, and affect 1,043 genes.
1 are Possibly Damaging.
0 are Probably Damaging.
115 are Probably Benign.
986 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 1235] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
MGI Phenotype question?
Posted question?
 
1 457914 UTSW 1520401A03Rik R5459 G1 225 N 17 23711843 C T intron 37 bp Het probably null 02/16/2017
2 266055 UTSW 1700001O22Rik R2082 G1 225 N 2 30796379 T A intron Het probably null 02/05/2015
3 334567 UTSW 1700003D09Rik R2858 G1 20 Y 11 98355319 T C intron Het probably benign 09/03/2015
4 478174 UTSW 1700007G11Rik LCD18 G1 999 Y 5 98707508 G A intron Het 05/26/2017
5 266065 UTSW 1700013D24Rik R2146 G1 225 N 6 124347844 A T intron Het probably null 02/05/2015
6 456108 UTSW 1700023F06Rik R5886 G1 225 N 11 103208121 A G intron 6 bp Het probably null 02/15/2017
7 356358 UTSW 1700028I16Rik R3836 G1 145 Y 10 82812385 A G intron Het 11/06/2015
8 359749 UTSW 1700028I16Rik R3837 G1 204 Y 10 82812385 A G intron Het 12/16/2015
9 359664 UTSW 1700028I16Rik R3839 G1 225 Y 10 82812385 A G intron Het 11/12/2015
10 478289 UTSW 1700028M03Rik LCD18 G1 318.88 Y 3 83571776 N intron Het 06/09/2017
11 264040 UTSW 1700060O08Rik R3116 G1 225 N 12 54067725 G A intron Het probably null 02/05/2015
12 266087 UTSW 1700084C06Rik R2137 G1 225 N 9 21110985 A G intron Het probably null 02/05/2015
13 265955 UTSW 1700112D23Rik R1755 G1 225 N 3 28713662 T A intron Het probably null 02/05/2015
14 461651 UTSW 1810062O18Rik R5922 G1 225 N 14 20552071 T C intron 3 bp Het probably null 02/28/2017
15 344974 UTSW 2210408I21Rik R4614 G1 225 Y 13 77254256 T G intron 39 bp Het probably null 09/25/2015
16 478228 UTSW 2610015P09Rik LCD18 G1 999 Y 16 43921801 G A intron Het 05/26/2017
17 157148 UTSW 2610507B11Rik R0244 G1 105 N 11 78286491 T A intron Het probably null 02/14/2014
18 453396 UTSW 2900041M22Rik IGL03055 G1 106 Y 11 117612246 T A intron Het 02/03/2017
19 191138 UTSW 4732465J04Rik R1717 G1 148 Y 10 95793779 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT intron Homo probably null 05/14/2014
20 478212 UTSW 4930447C04Rik LCD18 G1 999 Y 12 72901715 C T intron Het 05/26/2017
21 390857 UTSW 4930483K19Rik R5056 G1 225 Y 10 76552926 T G intron Het probably null 06/06/2016
22 431051 UTSW 4930511M06Rik R5508 G1 225 N 18 57538084 G A intron Het probably null 10/05/2016
23 431108 UTSW 4930511M06Rik R5509 G1 225 N 18 57538084 G A intron Het probably null 10/05/2016
24 431192 UTSW 4930511M06Rik R5510 G1 225 N 18 57538084 G A intron Het probably null 10/05/2016
25 431259 UTSW 4930511M06Rik R5511 G1 225 N 18 57538084 G A intron Het probably null 10/05/2016
26 261993 UTSW 4930516K23Rik R0650 G1 165 N 7 104003239 A G intron Het probably null 02/04/2015
27 261994 UTSW 4930516K23Rik R0652 G1 99 N 7 104003239 A G intron Het probably null 02/04/2015
28 404351 UTSW 4930516K23Rik R5303 G1 225 Y 7 104069032 T C intron Het probably null 07/22/2016
29 359705 UTSW 4930544M13Rik R4036 G1 225 Y 13 114607669 T C intron Het 12/02/2015
30 267607 UTSW 4930556J24Rik R3195 G1 225 Y 11 3975736 T C intron Het probably benign 02/18/2015
31 265937 UTSW 4931422A03Rik R1722 G1 225 N 2 103993928 A T intron Het probably null 02/05/2015
32 453345 UTSW 4932438A13Rik R5030 G1 225 Y 3 36943399 A G intron Het 02/01/2017
33 382268 UTSW 5330439B14Rik R4960 G1 225 N 6 142620783 A T intron Het probably null 04/27/2016
34 321001 UTSW 6330549D23Rik R4234 G1 225 N 3 96623657 T A intron Het probably null 06/12/2015
35 433396 UTSW 8030451A03Rik R5469 G1 225 N 4 64013925 T C intron 4 bp Het probably null 10/06/2016
36 435329 UTSW 9330182L06Rik R5555 G1 225 N 5 9422296 T A intron Het probably null 10/24/2016
37 444306 UTSW 9430060I03Rik R5665 G1 225 N 1 92937931 T A intron Het probably null 11/09/2016
38 478194 UTSW A330008L17Rik LCD18 G1 999 Y 8 99723425 A G intron Het 05/26/2017
39 256359 UTSW A630014C17Rik R2937 G1 225 Y 11 52282783 A T intron Het probably null 12/31/2014
40 256987 UTSW A630014C17Rik R2938 G1 225 Y 11 52282783 A T intron Het probably null 12/31/2014
41 265992 UTSW Aarsd1 R1909 G1 225 N 11 101410231 A C intron Het probably null 02/05/2015
42 261870 UTSW Abca8b R0226 G1 137 N 11 109957018 T C intron Het probably null 02/04/2015
43 435717 UTSW Abcb1a R5572 G1 212 Y 5 8715108 C T intron 45 bp Het probably null phenotype 10/24/2016
44 389235 UTSW Abcb4 R5022 G1 225 Y 5 8909054 T A intron Het probably null phenotype 06/06/2016
45 275363 UTSW Abcb5 R3825 G1 225 Y 12 118901352 C T intron 5 bp Het probably null 04/02/2015
46 328670 UTSW Abcc5 R4432 G1 225 Y 16 20368187 A T intron Het probably null phenotype 07/21/2015
47 328716 UTSW Abcc5 R4433 G1 225 Y 16 20368187 A T intron Het probably null phenotype 07/21/2015
48 399538 UTSW Abcf1 R5255 G1 225 N 17 35959737 A T intron Het probably null 07/06/2016
49 370006 UTSW Abhd5 R4818 G1 204 Y 9 122363800 T A intron Het probably null phenotype 02/04/2016
50 448027 UTSW Abhd5 R5786 G1 225 N 9 122363803 A G intron Het probably null phenotype 12/15/2016
51 98872 UTSW Abi3bp R0485 G1 106 Y 16 56604012 A G intron Het probably null 01/10/2014
52 427247 UTSW Ablim3 R5442 G1 225 N 18 61857225 A T intron Het probably null 09/01/2016
53 266036 UTSW Abtb1 R2050 G1 109 N 6 88840806 G A intron Het probably null 02/05/2015
54 261819 UTSW AC132131.1 R0312 G1 225 N 10 90512914 A G intron Het probably null 02/04/2015
55 98973 UTSW AC138665.1 R0662 G1 192 N 3 59606743 A T intron Het probably null 01/10/2014
56 262746 UTSW Acbd4 R1263 G1 205 N 11 103103851 T A intron Het probably null 02/04/2015
57 330388 UTSW Accsl R4472 G1 225 Y 2 93863992 G T intron Het probably null 07/21/2015
58 261941 UTSW Acd R0613 G1 225 N 8 105700568 A T intron Het probably null phenotype 02/04/2015
59 437186 UTSW Acin1 R5575 G1 165 N 14 54678738 C T intron 5 bp Het probably null 10/26/2016
60 437716 UTSW Acly R5594 G1 225 N 11 100522120 T C intron Het probably null phenotype 10/26/2016
61 262056 UTSW Acpp R0098 G1 83 N 9 104319945 C T intron Het probably null phenotype 02/04/2015
62 201350 UTSW Acsl1 R0019 G1 67 Y 8 46521250 T A intron Het probably null phenotype 06/02/2014
63 450111 UTSW Acss2 R5825 G1 225 N 2 155549178 T A intron Het probably null 12/20/2016
64 271579 UTSW Acta2 R1597 G1 211 Y 19 34252583 A T intron Het unknown phenotype 03/23/2015
65 266073 UTSW Adam19 R2092 G1 225 N 11 46060904 T G intron Het probably null phenotype 02/05/2015
66 374914 UTSW Adam5 R4866 G1 225 Y 8 24742156 A C intron Het probably null 03/17/2016
67 376089 UTSW Adam5 R4900 G1 217 Y 8 24742156 A C intron Het probably null 03/17/2016
68 261914 UTSW Adamts18 R0514 G1 132 N 8 113738769 C T intron Het probably null phenotype 02/04/2015
69 325103 UTSW Adamts18 R4376 G1 225 N 8 113773240 A T intron Het probably null phenotype 07/06/2015
70 447798 UTSW Adamtsl3 R5782 G1 225 N 7 82540286 T A intron Het probably null phenotype 12/15/2016
71 346170 UTSW Adap2os R4621 G1 225 Y 11 80174073 T A intron Het probably null 09/25/2015
72 271603 UTSW Adat1 R1972 G1 170 Y 8 111990418 A G intron Het unknown 03/23/2015
73 313258 UTSW Adcy4 R4021 G1 225 Y 14 55775178 C T intron 37 bp Het probably null phenotype 04/30/2015
74 313318 UTSW Adcy4 R4022 G1 225 Y 14 55775178 C T intron 37 bp Het probably null phenotype 04/30/2015
75 266204 UTSW Add3 R2926 G1 141 N 19 53226822 A G intron Het probably null phenotype 02/05/2015
76 470925 UTSW Add3 R5951 G1 225 N 19 53244289 A G intron Het probably null phenotype 03/31/2017
77 402578 UTSW Adgrb1 R5225 G1 201 Y 15 74577499 T A intron 6 bp Het probably null 07/22/2016
78 478243 UTSW Aff2 LCD18 G1 999 Y X 69747535 C A intron Het phenotype 05/26/2017
79 261901 UTSW AI118078 R0497 G1 171 N 9 55380884 C T intron Het probably null 02/04/2015
80 266077 UTSW Akp3 R2111 G1 225 N 1 87126885 A T intron Het probably null phenotype 02/05/2015
81 262024 UTSW Akr1c13 R0722 G1 218 N 13 4197932 A G intron Het probably null 02/04/2015
82 310550 UTSW Alas1 R3896 G1 225 Y 9 106241801 G T intron Het probably null phenotype 04/17/2015
83 317620 UTSW Alas1 R4091 G1 225 Y 9 106241801 G T intron Het probably null phenotype 05/15/2015
84 317744 UTSW Alas1 R4093 G1 225 Y 9 106241801 G T intron Het probably null phenotype 05/15/2015
85 317863 UTSW Alas1 R4095 G1 225 Y 9 106241801 G T intron Het probably null phenotype 05/15/2015
86 478240 UTSW Aldh1a1 LCD18 G1 999 Y 19 20626646 C A intron Het phenotype 05/26/2017
87 269024 UTSW Aldh7a1 R3552 G1 127 Y 18 56550292 T C intron 4 bp Het probably null phenotype 02/19/2015
88 343365 UTSW Alg12 R4567 G1 225 Y 15 88806353 T C intron 46 bp Het probably null 09/24/2015
89 398108 UTSW Alms1 R5233 G1 225 Y 6 85656371 T A intron Het probably null phenotype 07/06/2016
90 266011 UTSW Amdhd2 R1929 G1 186 N 17 24157886 T C intron Het probably null 02/05/2015
91 477031 UTSW Ank2 R2892 G1 225 N 3 127248243 T C intron Het probably null phenotype 05/15/2017
92 477109 UTSW Ank2 R2893 G1 225 N 3 127248243 T C intron Het probably null phenotype 05/15/2017
93 477119 UTSW Ank2 R2894 G1 225 N 3 127248243 T C intron Het probably null phenotype 05/15/2017
94 325792 UTSW Ank2 R4367 G1 225 Y 3 126946149 T C intron Het not run phenotype 07/06/2015
95 386547 UTSW Ank2 R5060 G1 225 Y 3 126945921 K2101E T C intron Het not run phenotype 06/06/2016
96 395192 UTSW Ank2 R5148 G1 212 Y 3 127025636 A T intron Het probably null phenotype 06/21/2016
97 404337 UTSW Ank2 R5303 G1 225 Y 3 126945804 F2140I A T intron Het not run phenotype 07/22/2016
98 424027 UTSW Ank2 R5355 G1 225 Y 3 126944049 S2725P A G intron Het not run phenotype 08/04/2016
99 380657 UTSW Ank3 R4932 G1 225 N 10 69898223 T A intron Het probably null phenotype 04/15/2016
100 95578 UTSW Ankar R1121 G1 225 N 1 72651663 G A intron Het probably null 01/05/2014
[records 1 to 100 of 1235] next >> last >|