Incidental Mutations

1,261 incidental mutations are currently displayed, and affect 1,055 genes.
3 are Possibly Damaging.
3 are Probably Damaging.
37 are Probably Benign.
998 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 1261] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
MGI Phenotype question?
Posted question?
 
1 457914 UTSW 1520401A03Rik R5459 G1 225 N 17 23711843 C T intron 37 bp Het probably null 02/16/2017
2 266055 UTSW 1700001O22Rik R2082 G1 225 N 2 30796379 T A intron 22 bp Het probably null 02/05/2015
3 334567 UTSW 1700003D09Rik R2858 G1 20 Y 11 98355319 T C intron Het noncoding transcript 09/03/2015
4 478174 UTSW 1700007G11Rik LCD18 G1 999 Y 5 98707508 G A intron Het 05/26/2017
5 266065 UTSW 1700013D24Rik R2146 G1 225 N 6 124347844 A T intron Het probably null 02/05/2015
6 456108 UTSW 1700023F06Rik R5886 G1 225 N 11 103208121 A G intron 6 bp Het probably null 02/15/2017
7 356358 UTSW 1700028I16Rik R3836 G1 145 Y 10 82812385 A G intron Het noncoding transcript 11/06/2015
8 359749 UTSW 1700028I16Rik R3837 G1 204 Y 10 82812385 A G intron Het noncoding transcript 12/16/2015
9 359664 UTSW 1700028I16Rik R3839 G1 225 Y 10 82812385 A G intron Het noncoding transcript 11/12/2015
10 264040 UTSW 1700060O08Rik R3116 G1 225 N 12 54067725 G A intron Het probably null 02/05/2015
11 266087 UTSW 1700084C06Rik R2137 G1 225 N 9 21110985 A G intron 21 bp Het probably null 02/05/2015
12 265955 UTSW 1700112D23Rik R1755 G1 225 N 3 28713662 T A intron Het probably null 02/05/2015
13 461651 UTSW 1810062O18Rik R5922 G1 225 N 14 20552071 T C intron 3 bp Het probably null 02/28/2017
14 344974 UTSW 2210408I21Rik R4614 G1 225 Y 13 77254256 T G intron 39 bp Het probably null 09/25/2015
15 157148 UTSW 2610507B11Rik R0244 G1 105 N 11 78286491 T A intron Het probably null 02/14/2014
16 453396 UTSW 2900041M22Rik IGL03055 G1 106 Y 11 117612246 T A intron Het noncoding transcript 02/03/2017
17 181470 APN 4732465J04Rik IGL01958 G1 10 95793797 I29T T C intron Het probably damaging 0.985 05/07/2014
18 65757 UTSW 4732465J04Rik R0080 G1 133 Y 10 95794578 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC intron Het probably null 08/19/2013
19 65771 UTSW 4732465J04Rik R0164 G1 161 Y 10 95794578 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC intron Het probably null 08/19/2013
20 191138 UTSW 4732465J04Rik R1717 G1 148 Y 10 95793779 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT intron Homo probably null 05/14/2014
21 390857 UTSW 4930483K19Rik R5056 G1 225 Y 10 76552926 T G intron Het probably null 06/06/2016
22 431051 UTSW 4930511M06Rik R5508 G1 225 N 18 57538084 G A intron Het probably null 10/05/2016
23 431108 UTSW 4930511M06Rik R5509 G1 225 N 18 57538084 G A intron Het probably null 10/05/2016
24 431192 UTSW 4930511M06Rik R5510 G1 225 Y 18 57538084 G A intron Het probably null 10/05/2016
25 431259 UTSW 4930511M06Rik R5511 G1 225 Y 18 57538084 G A intron Het probably null 10/05/2016
26 261993 UTSW 4930516K23Rik R0650 G1 165 N 7 104003239 A G intron Het probably null 02/04/2015
27 261994 UTSW 4930516K23Rik R0652 G1 99 N 7 104003239 A G intron Het probably null 02/04/2015
28 404351 UTSW 4930516K23Rik R5303 G1 225 Y 7 104069032 T C intron Het probably null 07/22/2016
29 359705 UTSW 4930544M13Rik R4036 G1 225 Y 13 114607669 T C intron Het noncoding transcript 12/02/2015
30 267607 UTSW 4930556J24Rik R3195 G1 225 Y 11 3975736 T C intron Het noncoding transcript 02/18/2015
31 265937 UTSW 4931422A03Rik R1722 G1 225 N 2 103993928 A T intron Het probably null 02/05/2015
32 453345 UTSW 4932438A13Rik R5030 G1 225 Y 3 36943399 A G intron Het noncoding transcript 02/01/2017
33 382268 UTSW 5330439B14Rik R4960 G1 225 N 6 142620783 A T intron Het probably null 04/27/2016
34 261816 UTSW 6230400D17Rik R0335 G1 225 N 14 20688715 T A intron Het probably null 02/04/2015
35 321001 UTSW 6330549D23Rik R4234 G1 225 N 3 96623657 T A intron Het probably null 06/12/2015
36 433396 UTSW 8030451A03Rik R5469 G1 225 N 4 64013925 T C intron 4 bp Het probably null 10/06/2016
37 435329 UTSW 9330182L06Rik R5555 G1 225 N 5 9422296 T A intron Het probably null 10/24/2016
38 444306 UTSW 9430060I03Rik R5665 G1 225 N 1 92937931 T A intron Het probably null 11/09/2016
39 484581 UTSW 9530077C05Rik LCD18 G1 2735.94 Y 9 22442083 N intron Het 08/15/2017
40 478194 UTSW A330008L17Rik LCD18 G1 999 Y 8 99723425 A G intron Het noncoding transcript 05/26/2017
41 256359 UTSW A630014C17Rik R2937 G1 225 Y 11 52282783 A T intron Het probably null 12/31/2014
42 256987 UTSW A630014C17Rik R2938 G1 225 Y 11 52282783 A T intron Het probably null 12/31/2014
43 265992 UTSW Aarsd1 R1909 G1 225 N 11 101410231 A C intron Het probably null 02/05/2015
44 261870 UTSW Abca8b R0226 G1 137 N 11 109957018 T C intron 45 bp Het probably null 02/04/2015
45 435717 UTSW Abcb1a R5572 G1 212 Y 5 8715108 C T intron 45 bp Het probably null phenotype 10/24/2016
46 389235 UTSW Abcb4 R5022 G1 225 Y 5 8909054 T A intron Het probably null phenotype 06/06/2016
47 275363 UTSW Abcb5 R3825 G1 225 Y 12 118901352 C T intron 5 bp Het probably null 04/02/2015
48 328670 UTSW Abcc5 R4432 G1 225 Y 16 20368187 A T intron Het probably null phenotype 07/21/2015
49 328716 UTSW Abcc5 R4433 G1 225 Y 16 20368187 A T intron Het probably null phenotype 07/21/2015
50 399538 UTSW Abcf1 R5255 G1 225 N 17 35959737 A T intron Het probably null 07/06/2016
51 370006 UTSW Abhd5 R4818 G1 204 Y 9 122363800 T A intron Het probably null phenotype 02/04/2016
52 448027 UTSW Abhd5 R5786 G1 225 N 9 122363803 A G intron Het probably null phenotype 12/15/2016
53 98872 UTSW Abi3bp R0485 G1 106 Y 16 56604012 A G intron Het probably null 01/10/2014
54 427247 UTSW Ablim3 R5442 G1 225 N 18 61857225 A T intron Het probably null 09/01/2016
55 266036 UTSW Abtb1 R2050 G1 109 N 6 88840806 G A intron 32 bp Het probably null 02/05/2015
56 98973 UTSW AC138665.1 R0662 G1 192 N 3 59606743 A T intron Het noncoding transcript 01/10/2014
57 262746 UTSW Acbd4 R1263 G1 205 N 11 103103851 T A intron Het probably null 02/04/2015
58 330388 UTSW Accsl R4472 G1 225 Y 2 93863992 G T intron Het probably null 07/21/2015
59 261941 UTSW Acd R0613 G1 225 N 8 105700568 A T intron Het probably null phenotype 02/04/2015
60 437186 UTSW Acin1 R5575 G1 165 Y 14 54678738 C T intron 5 bp Het probably null 10/26/2016
61 437716 UTSW Acly R5594 G1 225 Y 11 100522120 T C intron Het probably null phenotype 10/26/2016
62 262056 UTSW Acpp R0098 G1 83 N 9 104319945 C T intron 29 bp Het probably null phenotype 02/04/2015
63 201350 UTSW Acsl1 R0019 G1 67 Y 8 46521250 T A intron Het probably null phenotype 06/02/2014
64 450111 UTSW Acss2 R5825 G1 225 N 2 155549178 T A intron Het probably null 12/20/2016
65 271579 UTSW Acta2 R1597 G1 211 Y 19 34252583 A T intron Het phenotype 03/23/2015
66 266073 UTSW Adam19 R2092 G1 225 N 11 46060904 T G intron Het probably null phenotype 02/05/2015
67 374914 UTSW Adam5 R4866 G1 225 Y 8 24742156 A C intron Het probably null 03/17/2016
68 376089 UTSW Adam5 R4900 G1 217 Y 8 24742156 A C intron Het probably null 03/17/2016
69 261914 UTSW Adamts18 R0514 G1 132 N 8 113738769 C T intron 27 bp Het probably null phenotype 02/04/2015
70 325103 UTSW Adamts18 R4376 G1 225 N 8 113773240 A T intron Het probably null phenotype 07/06/2015
71 447798 UTSW Adamtsl3 R5782 G1 225 N 7 82540286 T A intron Het probably null phenotype 12/15/2016
72 346170 UTSW Adap2os R4621 G1 225 Y 11 80174073 T A intron Het probably null 09/25/2015
73 271603 UTSW Adat1 R1972 G1 170 Y 8 111990418 A G intron Het 03/23/2015
74 313258 UTSW Adcy4 R4021 G1 225 Y 14 55775178 C T intron 37 bp Het probably null phenotype 04/30/2015
75 313318 UTSW Adcy4 R4022 G1 225 Y 14 55775178 C T intron 37 bp Het probably null phenotype 04/30/2015
76 266204 UTSW Add3 R2926 G1 141 N 19 53226822 A G intron 93 bp Het probably null phenotype 02/05/2015
77 470925 UTSW Add3 R5951 G1 225 N 19 53244289 A G intron Het probably null phenotype 03/31/2017
78 402578 UTSW Adgrb1 R5225 G1 201 Y 15 74577499 T A intron 6 bp Het probably null 07/22/2016
79 282622 APN Adgrg6 IGL02164 10 14523555 T C intron Het noncoding transcript phenotype 04/16/2015
80 478243 UTSW Aff2 LCD18 G1 999 Y X 69747535 C A intron Het noncoding transcript phenotype 05/26/2017
81 266077 UTSW Akp3 R2111 G1 225 N 1 87126885 A T intron 23 bp Het probably null phenotype 02/05/2015
82 262024 UTSW Akr1c13 R0722 G1 218 N 13 4197932 A G intron 22 bp Het probably null 02/04/2015
83 310550 UTSW Alas1 R3896 G1 225 Y 9 106241801 G T intron Het probably null phenotype 04/17/2015
84 317620 UTSW Alas1 R4091 G1 225 Y 9 106241801 G T intron Het probably null phenotype 05/15/2015
85 317744 UTSW Alas1 R4093 G1 225 Y 9 106241801 G T intron Het probably null phenotype 05/15/2015
86 317863 UTSW Alas1 R4095 G1 225 Y 9 106241801 G T intron Het probably null phenotype 05/15/2015
87 478240 UTSW Aldh1a1 LCD18 G1 999 Y 19 20626646 C A intron Het phenotype 05/26/2017
88 269024 UTSW Aldh7a1 R3552 G1 127 Y 18 56550292 T C intron 4 bp Het probably null phenotype 02/19/2015
89 343365 UTSW Alg12 R4567 G1 225 Y 15 88806353 T C intron 46 bp Het probably null 09/24/2015
90 398108 UTSW Alms1 R5233 G1 225 Y 6 85656371 T A intron Het probably null phenotype 07/06/2016
91 266011 UTSW Amdhd2 R1929 G1 186 N 17 24157886 T C intron 32 bp Het probably null 02/05/2015
92 477031 UTSW Ank2 R2892 G1 225 N 3 127248243 T C intron Het probably null phenotype 05/15/2017
93 477109 UTSW Ank2 R2893 G1 225 N 3 127248243 T C intron Het probably null phenotype 05/15/2017
94 477119 UTSW Ank2 R2894 G1 225 N 3 127248243 T C intron Het probably null phenotype 05/15/2017
95 325792 UTSW Ank2 R4367 G1 225 Y 3 126946149 T2029A T C intron Het probably benign 0.000 phenotype 07/06/2015
96 386547 UTSW Ank2 R5060 G1 225 Y 3 126945921 K2018E T C intron Het possibly damaging 0.955 phenotype 06/06/2016
97 395192 UTSW Ank2 R5148 G1 212 Y 3 127025636 A T intron Het probably null phenotype 06/21/2016
98 404337 UTSW Ank2 R5303 G1 225 Y 3 126945804 F2057I A T intron Het probably damaging 0.976 phenotype 07/22/2016
99 424027 UTSW Ank2 R5355 G1 225 Y 3 126944049 S2729P A G intron Het probably damaging 0.958 phenotype 08/04/2016
100 438494 UTSW Ank2 R5582 G1 225 Y 3 126946305 I1890V T C intron Het probably benign 0.061 phenotype 10/26/2016
[records 1 to 100 of 1261] next >> last >|