Incidental Mutations

3,055 incidental mutations are currently displayed, and affect 2,187 genes.
13 are Possibly Damaging.
14 are Probably Damaging.
50 are Probably Benign.
891 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 3055] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 462477 UTSW 0610037L13Rik 0.223 R5940 G1 225 Y 4 107893288 A G intron Het noncoding transcript 0.064 02/28/2017
2 401247 UTSW 1110032A03Rik 0.143 R5258 G1 150 Y 9 50764333 T C intron Het noncoding transcript 07/06/2016
3 397644 UTSW 1110059E24Rik 0.095 R5182 G1 225 Y 19 21630765 M1T A G intron Het probably null 0.595 07/06/2016
4 457914 UTSW 1520401A03Rik 0.142 R5459 G1 225 N 17 23711843 C T intron 37 bp Het probably null 02/16/2017
5 266055 UTSW 1700001O22Rik 0.023 R2082 G1 225 N 2 30796379 T A intron 22 bp Het probably null 02/05/2015
6 478174 UTSW 1700007G11Rik 0.124 LCD18 G1 999 Y 5 98707508 G A intron Het 05/26/2017
7 81249 UTSW 1700007G11Rik 0.124 R0962 G1 225 Y 5 98566561 T C intron Het noncoding transcript 11/07/2013
8 217552 UTSW 1700007G11Rik 0.124 R1954 G1 225 Y 5 98566753 A T intron Het noncoding transcript 08/01/2014
9 266065 UTSW 1700013D24Rik 0.123 R2146 G1 225 N 6 124347844 A T intron Het probably null 02/05/2015
10 422361 UTSW 1700017D01Rik 0.063 R5341 G1 225 Y 19 11110381 T C intron Het noncoding transcript 08/04/2016
11 456108 UTSW 1700023F06Rik 0.025 R5886 G1 225 Y 11 103208121 A G intron 6 bp Het probably null 0.646 02/15/2017
12 356358 UTSW 1700028I16Rik 0.129 R3836 G1 145 Y 10 82812385 A G intron Het noncoding transcript 11/06/2015
13 359749 UTSW 1700028I16Rik 0.129 R3837 G1 204 Y 10 82812385 A G intron Het noncoding transcript 12/16/2015
14 359664 UTSW 1700028I16Rik 0.129 R3839 G1 225 Y 10 82812385 A G intron Het noncoding transcript 11/12/2015
15 324948 UTSW 2200002D01Rik 0.086 R4362 G1 225 Y 7 29248262 C T intron Het noncoding transcript 07/06/2015
16 344974 UTSW 2210408I21Rik 0.394 R4614 G1 225 Y 13 77254256 T G intron 39 bp Het probably null 0.624 09/25/2015
17 271571 UTSW 2310033P09Rik 0.279 R1476 G1 167 Y 11 59208702 A G intron Het noncoding transcript 0.057 03/23/2015
18 428240 UTSW 2310035C23Rik 0.468 R5435 G1 120 Y 1 105741250 T A intron Het noncoding transcript 09/01/2016
19 451567 UTSW 2310035C23Rik 0.468 R5734 G1 225 Y 1 105703883 T C intron Het noncoding transcript 0.018 01/03/2017
20 352707 UTSW 2410089E03Rik 0.429 R4659 G1 225 Y 15 8216276 G T intron Het noncoding transcript 0.064 phenotype 10/08/2015
21 320660 UTSW 2610020H08Rik 0.416 R4168 G1 225 Y 7 119827398 A G intron Het noncoding transcript 06/12/2015
22 320695 UTSW 2610020H08Rik 0.416 R4169 G1 225 Y 7 119827398 A G intron Het noncoding transcript 06/12/2015
23 157148 UTSW 2610507B11Rik 0.975 R0244 G1 105 N 11 78286491 T A intron Het probably null 02/14/2014
24 368375 UTSW 2610507B11Rik 0.975 R4196 G1 225 Y 11 78263556 A G intron Het noncoding transcript 02/02/2016
25 324392 UTSW 2700081O15Rik 0.200 R4326 G1 197 Y 19 7421226 A G intron Het noncoding transcript 0.068 06/24/2015
26 397274 UTSW 2700081O15Rik 0.200 R4329 G1 74 Y 19 7421226 A G intron Het noncoding transcript 0.068 07/05/2016
27 453396 UTSW 2900041M22Rik 0.130 IGL03055 G1 106 Y 11 117612246 T A intron Het noncoding transcript 0.061 02/03/2017
28 374169 UTSW 3110002H16Rik 0.654 R4826 G1 210 Y 18 12185779 G T intron Het noncoding transcript 0.050 03/01/2016
29 430948 UTSW 3110002H16Rik 0.654 R5506 G1 225 Y 18 12188956 A G intron Het noncoding transcript 0.064 10/05/2016
30 181470 APN 4732465J04Rik 0.168 IGL01958 G1 10 95793797 I29T T C intron Het probably damaging 0.985 05/07/2014
31 65757 UTSW 4732465J04Rik 0.168 R0080 G1 133 Y 10 95794578 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC intron Het probably null 08/19/2013
32 65771 UTSW 4732465J04Rik 0.168 R0164 G1 161 Y 10 95794578 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC intron Het probably null 08/19/2013
33 191138 UTSW 4732465J04Rik 0.168 R1717 G1 148 Y 10 95793779 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT intron Het probably null 05/14/2014
34 383829 UTSW 4833420G17Rik 0.200 R4964 G1 225 Y 13 119474221 T C intron Het noncoding transcript 0.062 04/27/2016
35 384042 UTSW 4833420G17Rik 0.200 R4966 G1 225 Y 13 119474221 T C intron Het noncoding transcript 0.062 04/27/2016
36 387950 UTSW 4833420G17Rik 0.200 R5093 G1 225 Y 13 119474037 C T intron Het noncoding transcript 06/06/2016
37 384139 UTSW 4930447C04Rik 0.324 R4967 G1 225 Y 12 72909728 Y199* A T intron Het probably null 0.613 04/27/2016
38 359705 UTSW 4930544M13Rik 0.171 R4036 G1 225 Y 13 114607669 T C intron Het noncoding transcript 0.040 12/02/2015
39 265937 UTSW 4931422A03Rik 0.128 R1722 G1 225 N 2 103993928 A T intron Het probably null 02/05/2015
40 368379 UTSW 4932414N04Rik 0.086 R4153 G1 66 Y 2 68668597 A T intron Het noncoding transcript 02/03/2016
41 348502 UTSW 4932438A13Rik 0.786 R4672 G1 225 Y 3 36889990 *330W A G intron Het probably null 0.647 10/08/2015
42 453345 UTSW 4932438A13Rik 0.786 R5030 G1 225 Y 3 36943399 A G intron Het noncoding transcript 0.065 02/01/2017
43 394507 UTSW 4932438A13Rik 0.786 R5049 G1 225 Y 3 37040506 T A intron Het noncoding transcript 0.063 06/15/2016
44 358160 UTSW 4933407L21Rik 0.022 R4743 G1 131 Y 1 85931251 A G intron Het noncoding transcript 0.055 11/11/2015
45 376865 UTSW 9530053A07Rik 0.071 R4876 G1 225 Y 7 28142800 A T intron Het noncoding transcript 03/17/2016
46 438082 UTSW 9530053A07Rik 0.071 R5613 G1 225 Y 7 28142878 A T intron Het noncoding transcript 10/26/2016
47 484581 UTSW 9530077C05Rik 0.219 LCD18 G1 2735.94 Y 9 22442083 N intron Het 0.100 08/15/2017
48 404600 UTSW 9930021J03Rik 0.397 R5306 G1 225 Y 19 29729830 A G intron 2 bp Het probably null 0.615 07/22/2016
49 478194 UTSW A330008L17Rik 0.076 LCD18 G1 999 Y 8 99723425 A G intron Het noncoding transcript 05/26/2017
50 351344 UTSW A830018L16Rik 0.137 R4652 G1 182 Y 1 11537342 C A intron Het noncoding transcript 10/08/2015
51 343283 UTSW A930011G23Rik R4565 G1 225 Y 5 99227947 T C intron Het noncoding transcript 09/24/2015
52 424834 UTSW Aadac 0.083 R5383 G1 219 Y 3 60036075 T C intron Het noncoding transcript 08/04/2016
53 314437 UTSW Aamp 0.985 R4112 G1 225 Y 1 74281227 A G intron Het noncoding transcript 0.071 05/14/2015
54 265992 UTSW Aarsd1 0.422 R1909 G1 225 N 11 101410231 A C intron Het probably null 02/05/2015
55 388339 UTSW Abca5 0.134 R5066 G1 225 Y 11 110309350 A T intron Het noncoding transcript 0.136 phenotype 06/06/2016
56 261870 UTSW Abca8b 0.290 R0226 G1 137 N 11 109957018 T C intron 45 bp Het probably null 02/04/2015
57 435717 UTSW Abcb1a 0.000 R5572 G1 212 Y 5 8715108 C T intron 45 bp Het probably null 0.627 phenotype 10/24/2016
58 389235 UTSW Abcb4 0.000 R5022 G1 225 Y 5 8909054 T A intron Het probably null 0.648 phenotype 06/06/2016
59 384036 UTSW Abcb5 0.276 R4966 G1 225 Y 12 118886891 T A intron Het noncoding transcript 0.057 04/27/2016
60 349323 UTSW Abcb6 0.620 R4633 G1 225 Y 1 75177782 A T intron Het noncoding transcript phenotype 10/08/2015
61 445287 UTSW Abcb8 0.303 R5761 G1 225 Y 5 24405881 T C intron Het noncoding transcript 0.062 phenotype 11/21/2016
62 328670 UTSW Abcc5 0.000 R4432 G1 225 Y 16 20368187 A T intron Het probably null 0.620 phenotype 07/21/2015
63 328716 UTSW Abcc5 0.000 R4433 G1 225 Y 16 20368187 A T intron Het probably null 0.620 phenotype 07/21/2015
64 386559 UTSW Abcc9 0.000 R5060 G1 225 Y 6 142626110 A G intron Het noncoding transcript phenotype 06/06/2016
65 442169 UTSW Abcc9 0.000 R5654 G1 225 Y 6 142625645 G A intron Het noncoding transcript phenotype 11/09/2016
66 451584 UTSW Abcc9 0.000 R5734 G1 225 Y 6 142625731 A G intron Het noncoding transcript phenotype 01/03/2017
67 354566 UTSW Abcf1 0.906 R4722 G1 225 Y 17 35958041 T C intron Het noncoding transcript 0.062 10/21/2015
68 394930 UTSW Abcf1 0.906 R5129 G1 225 Y 17 35960795 C T intron Het noncoding transcript 06/21/2016
69 399538 UTSW Abcf1 0.906 R5255 G1 225 N 17 35959737 A T intron Het probably null 07/06/2016
70 431553 UTSW Abcg4 0.000 R5521 G1 223 Y 9 44279683 A G intron Het noncoding transcript phenotype 10/05/2016
71 245220 UTSW Abhd12 0.000 R2298 G1 225 N 2 150901494 C A intron 1 bp Het probably null phenotype 10/30/2014
72 457560 UTSW Abhd16a 0.547 R5896 G1 225 Y 17 35091725 T A intron Het noncoding transcript 02/15/2017
73 435423 UTSW Abi2 0.000 R5557 G1 225 Y 1 60438912 C A intron Het noncoding transcript phenotype 10/24/2016
74 98872 UTSW Abi3bp 0.113 R0485 G1 106 Y 16 56604012 A G intron Het probably null 0.637 01/10/2014
75 427247 UTSW Ablim3 0.235 R5442 G1 225 N 18 61857225 A T intron Het probably null 09/01/2016
76 481516 UTSW Abraxas1 0.205 R5983 G1 219.01 Y 5 100807911 V237A A G intron Het probably benign 0.000 06/26/2017
77 249996 UTSW Acad11 0.000 R2411 G1 225 Y 9 104086023 T G intron Het noncoding transcript 0.090 phenotype 11/12/2014
78 308108 UTSW Acad11 0.000 R3954 G1 225 Y 9 104086152 A G intron Het noncoding transcript 0.070 phenotype 04/17/2015
79 310706 UTSW Acad11 0.000 R3956 G1 225 Y 9 104086152 A G intron Het noncoding transcript 0.070 phenotype 04/29/2015
80 376665 UTSW Acad11 0.000 R4872 G1 225 Y 9 104086266 G A intron Het noncoding transcript 0.102 phenotype 03/17/2016
81 471166 UTSW Acad9 0.855 R5956 G1 225 Y 3 36075174 A G intron Het noncoding transcript 0.057 03/31/2017
82 343155 UTSW Acap1 0.309 R4562 G1 225 Y 11 69885351 C T intron Het noncoding transcript 09/24/2015
83 371198 UTSW Acap3 0.360 R4822 G1 81 Y 4 155902451 T A intron Het noncoding transcript 0.102 03/01/2016
84 440033 UTSW Acat1 0.297 R5634 G1 225 Y 9 53583621 T C intron Het noncoding transcript 11/08/2016
85 262746 UTSW Acbd4 0.665 R1263 G1 205 N 11 103103851 T A intron Het probably null 02/04/2015
86 331984 UTSW Acbd4 0.665 R4505 G1 225 Y 11 103104779 A G intron Het noncoding transcript 07/21/2015
87 261941 UTSW Acd 0.000 R0613 G1 225 N 8 105700568 A T intron Het probably null phenotype 02/04/2015
88 262834 UTSW Ace 0.485 R1555 G1 225 N 11 105974901 A G intron 23 bp Het probably null phenotype 02/04/2015
89 325044 UTSW Acin1 0.944 R4374 G1 225 Y 14 54653894 C A intron Het noncoding transcript 07/06/2015
90 346180 UTSW Acin1 0.944 R4621 G1 225 Y 14 54653443 A T intron Het noncoding transcript 0.065 09/25/2015
91 388054 UTSW Acin1 0.944 R5096 G1 225 Y 14 54679222 A T intron Het noncoding transcript 06/06/2016
92 437716 UTSW Acly 1.000 R5594 G1 225 Y 11 100522120 T C intron Het probably null 0.631 phenotype 10/26/2016
93 319930 UTSW Acot4 0.033 R4190 G1 158 Y 12 84043174 T C intron Het noncoding transcript 06/10/2015
94 318366 UTSW Acot4 0.033 R4192 G1 132 Y 12 84043174 T C intron Het noncoding transcript 06/10/2015
95 394505 UTSW Acot8 0.235 R5049 G1 208 Y 2 164799690 A G intron Het noncoding transcript 06/15/2016
96 331727 UTSW Acot9 0.034 R4498 G1 222 Y X 155264068 L18* T A intron Het probably null 0.634 07/21/2015
97 262056 UTSW Acpp 0.000 R0098 G1 83 N 9 104319945 C T intron 29 bp Het probably null phenotype 02/04/2015
98 201350 UTSW Acsl1 0.000 R0019 G1 67 Y 8 46521250 T A intron Het probably null 0.638 phenotype 06/02/2014
99 397399 UTSW Acsl1 0.000 R5168 G1 225 Y 8 46513266 T A intron Het noncoding transcript phenotype 07/06/2016
100 428423 UTSW Acsm3 0.000 R5437 G1 225 Y 7 119778497 C A intron Het noncoding transcript phenotype 09/01/2016
[records 1 to 100 of 3055] next >> last >|