Incidental Mutations

1,113 incidental mutations are currently displayed, and affect 229 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
1,112 are Probably Benign.
0 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 1113] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 207681 UTSW 1110038F14Rik R1845 G1 131 N 15 76949663 CGGG CGGGGGG small insertion Het probably benign 06/23/2014
2 313366 UTSW 1110038F14Rik R4023 G1 153 N 15 76949663 CGGG CGGGGGG small insertion Het probably benign 04/30/2015
3 511035 UTSW 1700001K19Rik 0.049 FR4304 175.59 N 12 110668449 CTT CTTTTT small insertion Homo probably benign 04/05/2018
4 511036 UTSW 1700001K19Rik 0.049 FR4304 148.79 N 12 110668450 TTC TTCGTC small insertion Homo probably benign 04/05/2018
5 512099 UTSW 1700001K19Rik 0.049 FR4548 214.47 N 12 110668449 CTT CTTTTT small insertion Het probably benign 04/05/2018
6 512100 UTSW 1700001K19Rik 0.049 FR4548 217.47 N 12 110668452 CTT CTTTTT small insertion Het probably benign 04/05/2018
7 511718 UTSW 1700001K19Rik 0.049 FR4737 200.47 N 12 110668448 TCT TCTCCT small insertion Het probably benign 04/05/2018
8 511925 UTSW 1700001K19Rik 0.049 FR4976 201.47 N 12 110668447 TTC TTCATC small insertion Het probably benign 04/05/2018
9 511926 UTSW 1700001K19Rik 0.049 FR4976 187.47 N 12 110668450 TTC TTCGTC small insertion Het probably benign 04/05/2018
10 510963 UTSW 4930402H24Rik 0.238 FR4304 198.47 N 2 130770748 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
11 511206 UTSW 4930402H24Rik 0.238 FR4342 156.47 N 2 130770742 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
12 511319 UTSW 4930402H24Rik 0.238 FR4589 203.47 N 2 130770745 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
13 511320 UTSW 4930402H24Rik 0.238 FR4589 142.47 N 2 130770752 CC CCTGC small insertion Het probably benign phenotype 04/05/2018
14 511589 UTSW 4930402H24Rik 0.238 FR4737 145.47 N 2 130770752 CC CCTGC small insertion Het probably benign phenotype 04/05/2018
15 511809 UTSW 4930402H24Rik 0.238 FR4976 135.47 N 2 130770753 C CTCG small insertion Het probably benign phenotype 04/05/2018
16 511807 UTSW 4930402H24Rik 0.238 FR4976 150.47 N 2 130770739 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
17 511808 UTSW 4930402H24Rik 0.238 FR4976 147.47 N 2 130770742 TCC TCCACC small insertion Het probably benign phenotype 04/05/2018
18 512078 UTSW 4932415D10Rik 0.136 FR4548 214.46 N 10 82290996 G GTCATTA small insertion Homo probably benign 04/05/2018
19 156747 UTSW 4933415A04Rik R1332 G1 155 N 11 43587429 T TNNNNNNNNNNNNNNNNNN small insertion Het probably benign 02/11/2014
20 510980 UTSW Ahdc1 0.515 FR4304 214.46 N 4 133062759 CT CTCTT small insertion Homo probably benign phenotype 04/05/2018
21 512029 UTSW Ahdc1 0.515 FR4548 214.46 N 4 133062760 T TCCC small insertion Homo probably benign phenotype 04/05/2018
22 512028 UTSW Ahdc1 0.515 FR4548 214.46 N 4 133062757 TCC TCCCCC small insertion Homo probably benign phenotype 04/05/2018
23 511617 UTSW Ahdc1 0.515 FR4737 214.46 N 4 133062759 CT CTCGT small insertion Homo probably benign phenotype 04/05/2018
24 262108 UTSW Ahdc1 0.515 T0722 G3 217 N 711 4 133062754 ACCTCCT ACCTCCTCCT small insertion Het probably benign phenotype 02/04/2015
25 262152 UTSW Ahdc1 0.515 T0975 G3 108 N 714 4 133062754 ACCTCCT ACCTCCTCCT small insertion Het probably benign phenotype 02/04/2015
26 512140 UTSW AI837181 0.195 FR4548 132.49 N 19 5425237 CG CGGGG small insertion Het probably benign 04/05/2018
27 512139 UTSW AI837181 0.195 FR4548 131.47 N 19 5425231 CGG CGGGGG small insertion Het probably benign 04/05/2018
28 511980 UTSW AI837181 0.195 FR4976 111.47 N 19 5425229 GGC GGCCGC small insertion Het probably benign 04/05/2018
29 511897 UTSW Akap12 0.193 FR4976 218.26 N 10 4353837 AAA AAACAA small insertion Het probably benign phenotype 04/05/2018
30 511887 UTSW Alg9 0.246 FR4976 124.57 N 9 50775431 G GCGA small insertion Het probably benign phenotype 04/05/2018
31 511011 UTSW Alpk3 0.649 FR4304 217.47 N 7 81077762 TCT TCTGCT small insertion Het probably benign phenotype 04/05/2018
32 511661 UTSW Alpk3 0.649 FR4737 210.48 N 7 81077762 TCT TCTACT small insertion Het probably benign phenotype 04/05/2018
33 479784 UTSW Amer1 R6011 G1 133.97 N X 95427283 ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC small insertion Het probably benign phenotype 06/26/2017
34 511882 UTSW Amfr 0.532 FR4976 128.6 N 8 94012292 GCC GCCGGCGCGAGCTCC small insertion Het probably benign phenotype 04/05/2018
35 511074 UTSW Ankhd1 0.460 FR4304 217.47 N 18 36560924 GGCGGC GGCGGCTGCGGC small insertion Het probably benign 04/05/2018
36 510974 UTSW Ankrd35 0.104 FR4304 214.46 N 3 96683847 TAGC TAGCAGC small insertion Homo probably benign 04/05/2018
37 511605 UTSW Ankrd35 0.104 FR4737 214.46 N 3 96683849 GC GCTAC small insertion Homo probably benign 04/05/2018
38 511258 UTSW Anxa2 0.000 FR4342 130.47 N 9 69480205 CCC CCCACC small insertion Het probably benign phenotype 04/05/2018
39 511259 UTSW Anxa2 0.000 FR4342 154.47 N 9 69480210 C CCCA small insertion Het probably benign phenotype 04/05/2018
40 512069 UTSW Anxa2 0.000 FR4548 104.47 N 9 69480203 CCC CCCTCC small insertion Het probably benign phenotype 04/05/2018
41 511365 UTSW Anxa2 0.000 FR4589 149.47 N 9 69480210 C CCCA small insertion Het probably benign phenotype 04/05/2018
42 511302 UTSW Apc 0.984 FR4342 214.47 N 18 34281999 CAATAAAGC CAATAAAGCAAATAAAGC small insertion Homo probably benign phenotype 04/05/2018
43 511554 UTSW Apc 0.984 FR4449 217.47 N 18 34282000 AATAAAGC AATAAAGCCGATAAAGC small insertion Het probably benign phenotype 04/05/2018
44 511555 UTSW Apc 0.984 FR4449 217.47 N 18 34282005 AGC AGCCAATAACGC small insertion Het probably benign phenotype 04/05/2018
45 512138 UTSW Apc 0.984 FR4548 217.47 N 18 34281998 CCAATAAAG CCAATAAAGACAATAAAG small insertion Het probably benign phenotype 04/05/2018
46 511761 UTSW Apc 0.984 FR4737 219.23 N 18 34281999 CAATAAAGC CAATAAAGCTAATAAAGC small insertion Homo probably benign phenotype 04/05/2018
47 511973 UTSW Apc 0.984 FR4976 217.47 N 18 34281998 CCAATAAAG CCAATAAAGTCAATAAAG small insertion Het probably benign phenotype 04/05/2018
48 511974 UTSW Apc 0.984 FR4976 217.47 N 18 34282000 AATAAAGC AATAAAGCCTATAAAGC small insertion Het probably benign phenotype 04/05/2018
49 510951 UTSW Arhgap30 0.178 FR4304 217.47 N 1 171405168 TGGCCC TGGCCCTGGCCCAGGCCTTGGCCCCGGCCC small insertion Het probably benign 04/05/2018
50 511538 UTSW Arid1b 0.480 FR4449 102.47 N 17 4995589 CGG CGGTGG small insertion Het probably benign phenotype 04/05/2018
51 258600 UTSW Asap3 0.192 R3703 G1 217 Y 4 136241241 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA small insertion Het probably benign 0.116 phenotype 01/23/2015
52 258643 UTSW Asap3 0.192 R3704 G1 217 Y 4 136241241 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA small insertion Het probably benign 0.116 phenotype 01/23/2015
53 258694 UTSW Asap3 0.192 R3705 G1 217 Y 4 136241241 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA small insertion Het probably benign 0.116 phenotype 01/23/2015
54 397913 UTSW Asic1 0.264 R5186 G1 217 N 15 99698803 GCACC GCACCACC small insertion Het probably benign phenotype 07/06/2016
55 397986 UTSW Asic1 0.264 R5187 G1 217 N 15 99698803 GCACC GCACCACC small insertion Het probably benign phenotype 07/06/2016
56 426467 UTSW Asic1 0.264 R5409 G1 217 N 15 99698803 GCACC GCACCACC small insertion Het probably benign phenotype 09/01/2016
57 482824 UTSW Atp2b4 0.287 R6078 G1 188.47 N 1 133701702 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT small insertion Het probably benign phenotype 07/14/2017
58 482846 UTSW Atp2b4 0.287 R6079 G1 122.47 N 1 133701702 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT small insertion Het probably benign phenotype 07/14/2017
59 96244 UTSW AU022751 0.038 R1015 G1 217 N X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 01/05/2014
60 98227 UTSW AU022751 0.038 R1102 G1 214 Y X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 01/05/2014
61 168588 UTSW AU022751 0.038 R1513 G1 214 N X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 04/13/2014
62 209501 UTSW AU022751 0.038 R1885 G1 214 N X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 06/30/2014
63 209606 UTSW AU022751 0.038 R1886 G1 214 N X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 06/30/2014
64 209700 UTSW AU022751 0.038 R1887 G1 152 N X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 06/30/2014
65 225804 UTSW AU022751 0.038 R1996 G1 214 Y X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 08/25/2014
66 511528 UTSW B430218F22Rik 0.118 FR4449 215.1 N 13 118386851 CGGCG CGGCGATGGCG small insertion Homo probably benign 04/05/2018
67 511062 UTSW BC051142 0.127 FR4304 196.47 N 17 34460055 A AGCC small insertion Het probably benign 04/05/2018
68 511063 UTSW BC051142 0.127 FR4304 203.47 N 17 34460077 GC GCATC small insertion Het probably benign 04/05/2018
69 511186 UTSW BC051142 0.127 FR4340 185.47 N 17 34460068 GCA GCATCA small insertion Het probably benign 04/05/2018
70 511187 UTSW BC051142 0.127 FR4340 184.47 N 17 34460077 GC GCAAC small insertion Het probably benign 04/05/2018
71 512130 UTSW BC051142 0.127 FR4548 157.47 N 17 34460065 GCA GCATCA small insertion Het probably benign 04/05/2018
72 511420 UTSW BC051142 0.127 FR4589 128.47 N 17 34460053 GCA GCACCA small insertion Het probably benign 04/05/2018
73 511421 UTSW BC051142 0.127 FR4589 155.47 N 17 34460073 AGC AGCCGC small insertion Het probably benign 04/05/2018
74 511748 UTSW BC051142 0.127 FR4737 172.47 N 17 34460051 CAG CAGAAG small insertion Het probably benign 04/05/2018
75 511749 UTSW BC051142 0.127 FR4737 189.47 N 17 34460068 GCA GCATCA small insertion Het probably benign 04/05/2018
76 511956 UTSW BC051142 0.127 FR4976 211.47 N 17 34460058 AGC AGCGGC small insertion Het probably benign 04/05/2018
77 511957 UTSW BC051142 0.127 FR4976 187.47 N 17 34460061 AGC AGCGGC small insertion Het probably benign 04/05/2018
78 237150 UTSW Bdp1 0.926 R2180 G1 194 N 13 100061405 ATTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTC small insertion Het probably benign phenotype 10/02/2014
79 511283 UTSW Begain 0.124 FR4342 123.97 N 12 109033418 CCCCGCC CCCCGCCCCCGCC small insertion Homo probably benign 04/05/2018
80 511010 UTSW Blm 1.000 FR4304 181.47 N 7 80512919 TCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCC small insertion Het probably benign phenotype 04/05/2018
81 511132 UTSW Blm 1.000 FR4340 178.47 N 7 80512907 TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCGCCTCCTCCTCCTCCTCCTCCTCC small insertion Het probably benign phenotype 04/05/2018
82 511133 UTSW Blm 1.000 FR4340 195.47 N 7 80512910 TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCCTCCTCCTCCTCC small insertion Het probably benign phenotype 04/05/2018
83 511483 UTSW Blm 1.000 FR4449 176.47 N 7 80512908 CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTTCTCCTCCTCCTCCTCCTCCTCCT small insertion Het probably benign phenotype 04/05/2018
84 511869 UTSW Blm 1.000 FR4976 217.47 N 7 80512907 TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCCTCCTCCTCCTCC small insertion Het probably benign phenotype 04/05/2018
85 511021 UTSW Btnl10 0.144 FR4304 214.46 N 11 58923930 GA GAATA small insertion Homo probably benign 04/05/2018
86 511511 UTSW Btnl10 0.144 FR4449 214.46 N 11 58923928 AAG AAGGAG small insertion Homo probably benign 04/05/2018
87 511382 UTSW Btnl10 0.144 FR4589 214.46 N 11 58923929 AGA AGAGGA small insertion Homo probably benign 04/05/2018
88 511694 UTSW Btnl10 0.144 FR4737 214.46 N 11 58923931 A AAGG small insertion Homo probably benign 04/05/2018
89 511909 UTSW Btnl10 0.144 FR4976 212.47 N 11 58923929 AGA AGAGGA small insertion Homo probably benign 04/05/2018
90 511141 UTSW Cacna1a 0.676 FR4340 153.47 N 8 84638723 ACC ACCGCC small insertion Het probably benign phenotype 04/05/2018
91 511486 UTSW Cacna1a 0.676 FR4449 217.47 N 8 84638714 ACC ACCCCC small insertion Het probably benign phenotype 04/05/2018
92 511487 UTSW Cacna1a 0.676 FR4449 217.47 N 8 84638720 ACC ACCCCC small insertion Het probably benign phenotype 04/05/2018
93 511488 UTSW Cacna1a 0.676 FR4449 217.47 N 8 84638723 ACC ACCGCC small insertion Het probably benign phenotype 04/05/2018
94 512062 UTSW Cacna1a 0.676 FR4548 217.47 N 8 84638717 ACC ACCCCC small insertion Het probably benign phenotype 04/05/2018
95 511668 UTSW Cacna1a 0.676 FR4737 217.49 N 8 84638720 ACC ACCGCC small insertion Het probably benign phenotype 04/05/2018
96 511669 UTSW Cacna1a 0.676 FR4737 214.46 N 8 84638726 ACC ACCCCC small insertion Homo probably benign phenotype 04/05/2018
97 511880 UTSW Cacna1a 0.676 FR4976 217.47 N 8 84638717 ACC ACCGCC small insertion Het probably benign phenotype 04/05/2018
98 511881 UTSW Cacna1a 0.676 FR4976 217.73 N 8 84638726 ACC ACCTCC small insertion Het probably benign phenotype 04/05/2018
99 511080 UTSW Cacna1f 0.365 FR4304 106.47 N X 7620061 AGG AGGCGG small insertion Het probably benign phenotype 04/05/2018
100 511198 UTSW Cacna1f 0.365 FR4340 111.47 N X 7620067 AGG AGGCGG small insertion Het probably benign phenotype 04/05/2018
[records 1 to 100 of 1113] next >> last >|