Incidental Mutations

686 incidental mutations are currently displayed, and affect 155 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
686 are Probably Benign.
0 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 686] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 207681 UTSW 1110038F14Rik R1845 G1 131 N 15 76949663 CGGG CGGGGGG small insertion Het probably benign 06/23/2014
2 313366 UTSW 1110038F14Rik R4023 G1 153 N 15 76949663 CGGG CGGGGGG small insertion Het probably benign 04/30/2015
3 510963 UTSW 4930402H24Rik 0.225 FR4304 198.47 N 2 130770748 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
4 511206 UTSW 4930402H24Rik 0.225 FR4342 156.47 N 2 130770742 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
5 511319 UTSW 4930402H24Rik 0.225 FR4589 203.47 N 2 130770745 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
6 511320 UTSW 4930402H24Rik 0.225 FR4589 142.47 N 2 130770752 CC CCTGC small insertion Het probably benign phenotype 04/05/2018
7 511589 UTSW 4930402H24Rik 0.225 FR4737 145.47 N 2 130770752 CC CCTGC small insertion Het probably benign phenotype 04/05/2018
8 511808 UTSW 4930402H24Rik 0.225 FR4976 147.47 N 2 130770742 TCC TCCACC small insertion Het probably benign phenotype 04/05/2018
9 511809 UTSW 4930402H24Rik 0.225 FR4976 135.47 N 2 130770753 C CTCG small insertion Het probably benign phenotype 04/05/2018
10 511807 UTSW 4930402H24Rik 0.225 FR4976 150.47 N 2 130770739 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
11 512078 UTSW 4932415D10Rik 0.130 FR4548 214.46 N 10 82290996 G GTCATTA small insertion Homo probably benign 04/05/2018
12 156747 UTSW 4933415A04Rik R1332 G1 155 N 11 43587429 T TNNNNNNNNNNNNNNNNNN small insertion Het probably benign 02/11/2014
13 510980 UTSW Ahdc1 0.542 FR4304 214.46 N 4 133062759 CT CTCTT small insertion Homo probably benign phenotype 04/05/2018
14 512028 UTSW Ahdc1 0.542 FR4548 214.46 N 4 133062757 TCC TCCCCC small insertion Homo probably benign phenotype 04/05/2018
15 512029 UTSW Ahdc1 0.542 FR4548 214.46 N 4 133062760 T TCCC small insertion Homo probably benign phenotype 04/05/2018
16 511617 UTSW Ahdc1 0.542 FR4737 214.46 N 4 133062759 CT CTCGT small insertion Homo probably benign phenotype 04/05/2018
17 262108 UTSW Ahdc1 0.542 T0722 G3 217 N 711 4 133062754 ACCTCCT ACCTCCTCCT small insertion Het probably benign phenotype 02/04/2015
18 262152 UTSW Ahdc1 0.542 T0975 G3 108 N 714 4 133062754 ACCTCCT ACCTCCTCCT small insertion Het probably benign phenotype 02/04/2015
19 512140 UTSW AI837181 0.198 FR4548 132.49 N 19 5425237 CG CGGGG small insertion Het probably benign 04/05/2018
20 512139 UTSW AI837181 0.198 FR4548 131.47 N 19 5425231 CGG CGGGGG small insertion Het probably benign 04/05/2018
21 511980 UTSW AI837181 0.198 FR4976 111.47 N 19 5425229 GGC GGCCGC small insertion Het probably benign 04/05/2018
22 511897 UTSW Akap12 0.174 FR4976 218.26 N 10 4353837 AAA AAACAA small insertion Het probably benign phenotype 04/05/2018
23 511011 UTSW Alpk3 0.620 FR4304 217.47 N 7 81077762 TCT TCTGCT small insertion Het probably benign phenotype 04/05/2018
24 511661 UTSW Alpk3 0.620 FR4737 210.48 N 7 81077762 TCT TCTACT small insertion Het probably benign phenotype 04/05/2018
25 479784 UTSW Amer1 R6011 G1 133.97 N X 95427283 ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC small insertion Het probably benign phenotype 06/26/2017
26 511074 UTSW Ankhd1 0.445 FR4304 217.47 N 18 36560924 GGCGGC GGCGGCTGCGGC small insertion Het probably benign 04/05/2018
27 511259 UTSW Anxa2 0.000 FR4342 154.47 N 9 69480210 C CCCA small insertion Het probably benign phenotype 04/05/2018
28 511258 UTSW Anxa2 0.000 FR4342 130.47 N 9 69480205 CCC CCCACC small insertion Het probably benign phenotype 04/05/2018
29 512069 UTSW Anxa2 0.000 FR4548 104.47 N 9 69480203 CCC CCCTCC small insertion Het probably benign phenotype 04/05/2018
30 511365 UTSW Anxa2 0.000 FR4589 149.47 N 9 69480210 C CCCA small insertion Het probably benign phenotype 04/05/2018
31 510951 UTSW Arhgap30 0.150 FR4304 217.47 N 1 171405168 TGGCCC TGGCCCTGGCCCAGGCCTTGGCCCCGGCCC small insertion Het probably benign 04/05/2018
32 511538 UTSW Arid1b 0.435 FR4449 102.47 N 17 4995589 CGG CGGTGG small insertion Het probably benign phenotype 04/05/2018
33 258600 UTSW Asap3 0.163 R3703 G1 217 Y 4 136241241 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA small insertion Het probably benign 0.116 phenotype 01/23/2015
34 258643 UTSW Asap3 0.163 R3704 G1 217 Y 4 136241241 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA small insertion Het probably benign 0.116 phenotype 01/23/2015
35 258694 UTSW Asap3 0.163 R3705 G1 217 Y 4 136241241 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA small insertion Het probably benign 0.116 phenotype 01/23/2015
36 482824 UTSW Atp2b4 0.260 R6078 G1 188.47 N 1 133701702 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT small insertion Het probably benign phenotype 07/14/2017
37 482846 UTSW Atp2b4 0.260 R6079 G1 122.47 N 1 133701702 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT small insertion Het probably benign phenotype 07/14/2017
38 96244 UTSW AU022751 0.026 R1015 G1 217 N X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 01/05/2014
39 98227 UTSW AU022751 0.026 R1102 G1 214 Y X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 01/05/2014
40 168588 UTSW AU022751 0.026 R1513 G1 214 N X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 04/13/2014
41 209501 UTSW AU022751 0.026 R1885 G1 214 N X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 06/30/2014
42 209606 UTSW AU022751 0.026 R1886 G1 214 N X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 06/30/2014
43 209700 UTSW AU022751 0.026 R1887 G1 152 N X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 06/30/2014
44 225804 UTSW AU022751 0.026 R1996 G1 214 Y X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 08/25/2014
45 511528 UTSW B430218F22Rik 0.074 FR4449 215.1 N 13 118386851 CGGCG CGGCGATGGCG small insertion Homo probably benign 04/05/2018
46 538014 UTSW BC028528 0.043 R6841 G1 152.72 N 3 95888136 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT small insertion Het probably benign 10/18/2018
47 527100 UTSW Bcl9l 0.784 R6670 G1 217.47 N 9 44507072 GTGAACATGAACATGAACATGAAC GTGAACATGAACATGAACATGAACATGAAC small insertion Het probably benign phenotype 07/23/2018
48 527101 UTSW Bcl9l 0.784 R6670 G1 184.47 N 9 44507085 TGAACA TGAACACGAACA small insertion Het probably benign phenotype 07/23/2018
49 527141 UTSW Bcl9l 0.784 R6671 G1 217.47 N 9 44507072 GTGAACATGAACATGAACATGAAC GTGAACATGAACATGAACATGAACATGAAC small insertion Het probably benign phenotype 07/23/2018
50 527142 UTSW Bcl9l 0.784 R6671 G1 210.47 N 9 44507074 GAACAT GAACATAAACAT small insertion Het probably benign phenotype 07/23/2018
51 237150 UTSW Bdp1 0.941 R2180 G1 194 N 13 100061405 ATTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTC small insertion Het probably benign phenotype 10/02/2014
52 511010 UTSW Blm 1.000 FR4304 181.47 N 7 80512919 TCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCC small insertion Het probably benign phenotype 04/05/2018
53 511133 UTSW Blm 1.000 FR4340 195.47 N 7 80512910 TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCCTCCTCCTCCTCC small insertion Het probably benign phenotype 04/05/2018
54 511132 UTSW Blm 1.000 FR4340 178.47 N 7 80512907 TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCGCCTCCTCCTCCTCCTCCTCCTCC small insertion Het probably benign phenotype 04/05/2018
55 511483 UTSW Blm 1.000 FR4449 176.47 N 7 80512908 CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTTCTCCTCCTCCTCCTCCTCCTCCT small insertion Het probably benign phenotype 04/05/2018
56 511869 UTSW Blm 1.000 FR4976 217.47 N 7 80512907 TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCCTCCTCCTCCTCC small insertion Het probably benign phenotype 04/05/2018
57 511021 UTSW Btnl10 0.150 FR4304 214.46 N 11 58923930 GA GAATA small insertion Homo probably benign 04/05/2018
58 511511 UTSW Btnl10 0.150 FR4449 214.46 N 11 58923928 AAG AAGGAG small insertion Homo probably benign 04/05/2018
59 511382 UTSW Btnl10 0.150 FR4589 214.46 N 11 58923929 AGA AGAGGA small insertion Homo probably benign 04/05/2018
60 511694 UTSW Btnl10 0.150 FR4737 214.46 N 11 58923931 A AAGG small insertion Homo probably benign 04/05/2018
61 511909 UTSW Btnl10 0.150 FR4976 212.47 N 11 58923929 AGA AGAGGA small insertion Homo probably benign 04/05/2018
62 511141 UTSW Cacna1a 0.712 FR4340 153.47 N 8 84638723 ACC ACCGCC small insertion Het probably benign phenotype 04/05/2018
63 511488 UTSW Cacna1a 0.712 FR4449 217.47 N 8 84638723 ACC ACCGCC small insertion Het probably benign phenotype 04/05/2018
64 511486 UTSW Cacna1a 0.712 FR4449 217.47 N 8 84638714 ACC ACCCCC small insertion Het probably benign phenotype 04/05/2018
65 511487 UTSW Cacna1a 0.712 FR4449 217.47 N 8 84638720 ACC ACCCCC small insertion Het probably benign phenotype 04/05/2018
66 512062 UTSW Cacna1a 0.712 FR4548 217.47 N 8 84638717 ACC ACCCCC small insertion Het probably benign phenotype 04/05/2018
67 511668 UTSW Cacna1a 0.712 FR4737 217.49 N 8 84638720 ACC ACCGCC small insertion Het probably benign phenotype 04/05/2018
68 511669 UTSW Cacna1a 0.712 FR4737 214.46 N 8 84638726 ACC ACCCCC small insertion Homo probably benign phenotype 04/05/2018
69 511881 UTSW Cacna1a 0.712 FR4976 217.73 N 8 84638726 ACC ACCTCC small insertion Het probably benign phenotype 04/05/2018
70 511880 UTSW Cacna1a 0.712 FR4976 217.47 N 8 84638717 ACC ACCGCC small insertion Het probably benign phenotype 04/05/2018
71 511015 UTSW Ccdc170 0.181 FR4304 130.47 N 10 4561021 CCA CCATCA small insertion Het probably benign phenotype 04/05/2018
72 512075 UTSW Ccdc170 0.181 FR4548 118.47 N 10 4561026 ACC ACCCCC small insertion Het probably benign phenotype 04/05/2018
73 511688 UTSW Ccdc170 0.181 FR4737 188.47 N 10 4561023 ACC ACCTCC small insertion Het probably benign phenotype 04/05/2018
74 511689 UTSW Ccdc170 0.181 FR4737 128.51 N 10 4561029 AC ACCCC small insertion Het probably benign phenotype 04/05/2018
75 511898 UTSW Ccdc170 0.181 FR4976 142.47 N 10 4561008 ACCGCC ACCGCCGCC small insertion Het probably benign phenotype 04/05/2018
76 511899 UTSW Ccdc170 0.181 FR4976 170.47 N 10 4561023 ACC ACCGCC small insertion Het probably benign phenotype 04/05/2018
77 511900 UTSW Ccdc170 0.181 FR4976 173.88 N 10 4561029 AC ACCTC small insertion Het probably benign phenotype 04/05/2018
78 511033 UTSW Ccdc85c 0.310 FR4304 189.73 N 12 108274612 GCC GCCCCC small insertion Het probably benign phenotype 04/05/2018
79 511526 UTSW Ccdc85c 0.310 FR4449 141.54 N 12 108274616 CCG CCGACG small insertion Het probably benign phenotype 04/05/2018
80 511057 UTSW Cd80 0.128 FR4304 214.46 N 16 38486315 AGA AGAGGA small insertion Homo probably benign phenotype 04/05/2018
81 511179 UTSW Cd80 0.128 FR4340 214.46 N 16 38486316 GAA GAAAAA small insertion Homo probably benign phenotype 04/05/2018
82 512124 UTSW Cd80 0.128 FR4548 207.54 N 16 38486319 GAAA GAAAAAA small insertion Homo probably benign phenotype 04/05/2018
83 511527 UTSW Cdhr2 0.077 FR4449 214.49 N 13 54725924 AGTC AGTCGTC small insertion Homo probably benign phenotype 04/05/2018
84 511440 UTSW Cdk15 0.187 FR4449 218 N 1 59257823 A ATCTAAAAGG small insertion Homo probably benign 04/05/2018
85 225363 UTSW Cdkn1b 0.809 R2005 G1 217 N 6 134921956 ATTCTTCTTC ATTCTTCTTCTTC small insertion Het probably benign phenotype 08/25/2014
86 511557 UTSW Cdx1 0.519 FR4449 217.47 N 18 61019881 GCTG GCTGCTCCTG small insertion Het probably benign phenotype 04/05/2018
87 511763 UTSW Cdx1 0.519 FR4737 217.47 N 18 61019874 TGCTGC TGCTGCCGCTGC small insertion Het probably benign phenotype 04/05/2018
88 511764 UTSW Cdx1 0.519 FR4737 217.47 N 18 61019878 GCTGCT GCTGCTTCTGCT small insertion Het probably benign phenotype 04/05/2018
89 511976 UTSW Cdx1 0.519 FR4976 217.47 N 18 61019867 GGGCTGC GGGCTGCGGCTGC small insertion Het probably benign phenotype 04/05/2018
90 511977 UTSW Cdx1 0.519 FR4976 217.47 N 18 61019869 GCTGCT GCTGCTTCTGCT small insertion Het probably benign phenotype 04/05/2018
91 249020 UTSW Cfap65 0.313 R2417 G1 217 N 1 74927186 GTCTT GTCTTCTT small insertion Het probably benign phenotype 11/12/2014
92 512070 UTSW Cgnl1 0.215 FR4548 212.47 N 9 71724717 CGC CGCGGC small insertion Het probably benign phenotype 04/05/2018
93 511398 UTSW Chga 0.150 FR4589 116.47 N 12 102561402 AGC AGCTGC small insertion Het probably benign phenotype 04/05/2018
94 378694 UTSW Cic 0.752 R4922 G1 126 N 7 25291670 TCCCCC TCCCCCCCC small insertion Het probably benign phenotype 04/15/2016
95 395001 UTSW Cic 0.752 R5131 G1 128 N 7 25291670 TCCCCC TCCCCCCCC small insertion Het probably benign phenotype 06/21/2016
96 511274 UTSW Cluh 0.606 FR4342 217.47 N 11 74669526 GCCTGA GCCTGAACCTGA small insertion Het probably benign phenotype 04/05/2018
97 511273 UTSW Cluh 0.606 FR4342 217.47 N 11 74669524 GAGCCT GAGCCTCAGCCT small insertion Het probably benign phenotype 04/05/2018
98 511512 UTSW Cluh 0.606 FR4449 192.47 N 11 74669532 G GACTGAA small insertion Het probably benign phenotype 04/05/2018
99 511386 UTSW Cluh 0.606 FR4589 217.47 N 11 74669531 AGCC AGCCTGGGCC small insertion Het probably benign phenotype 04/05/2018
100 511699 UTSW Cluh 0.606 FR4737 217.47 N 11 74669533 CC CCTGAGGC small insertion Het probably benign phenotype 04/05/2018
[records 1 to 100 of 686] next >> last >|