Incidental Mutations

847 incidental mutations are currently displayed, and affect 418 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
843 are Probably Benign.
3 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 847] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 66158 UTSW 1110002E22Rik 0.263 R0239 G1 153 N 3 138065834 TTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCC small deletion Het probably benign 08/19/2013
2 66840 UTSW 1700016K19Rik 0.054 R0025 G1 109 N 11 76000115 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 08/19/2013
3 535605 UTSW 1700021F05Rik 0.378 R6850 G1 217.47 N 10 43532725 ACTGCACCACCT ACT small deletion Het probably benign 09/12/2018
4 535932 UTSW 1700021F05Rik 0.378 R6866 G1 217.47 N 10 43532725 ACTGCACCACCT ACT small deletion Het probably benign 10/18/2018
5 535983 UTSW 1700021F05Rik 0.378 R6867 G1 217.47 N 10 43532725 ACTGCACCACCT ACT small deletion Het probably benign 10/18/2018
6 270815 UTSW 4930402K13Rik 0.021 R3726 G1 214 Y X 9105103 AGAGGAG AGAG small deletion Het probably benign 03/18/2015
7 511007 UTSW 4930433I11Rik 0.092 FR4304 217.47 N 7 40993056 ACCTC AC small deletion Het probably benign 04/05/2018
8 511129 UTSW 4930433I11Rik 0.092 FR4340 217.47 N 7 40993055 AACC A small deletion Het probably benign 04/05/2018
9 511245 UTSW 4930433I11Rik 0.092 FR4342 186.47 N 7 40993055 AACC A small deletion Het probably benign 04/05/2018
10 512052 UTSW 4930433I11Rik 0.092 FR4548 217.47 N 7 40993056 ACCTC AC small deletion Het probably benign 04/05/2018
11 511032 UTSW 4930447C04Rik 0.326 FR4304 105.46 N 12 72881287 AAGT A small deletion Homo probably benign phenotype 04/05/2018
12 510989 UTSW 4930548H24Rik 0.077 FR4304 214.46 N 5 31487373 GAGAAG GAG small deletion Homo probably benign 04/05/2018
13 511114 UTSW 4930548H24Rik 0.077 FR4340 217.47 N 5 31487373 GAGAAG GAG small deletion Het probably benign 04/05/2018
14 511231 UTSW 4930548H24Rik 0.077 FR4342 214.46 N 5 31487373 GAGAAG GAG small deletion Homo probably benign 04/05/2018
15 511339 UTSW 4930548H24Rik 0.077 FR4589 217.47 N 5 31487373 GAGAAG GAG small deletion Het probably benign 04/05/2018
16 478031 UTSW 4930548H24Rik 0.077 LCD18 G1 999 Y 5 31487373 GAGAAG GAG small deletion Het probably benign 05/17/2017
17 511690 UTSW 4932415D10Rik 0.129 FR4737 134.46 N 10 82285469 TTCA T small deletion Homo probably benign 04/05/2018
18 152388 UTSW 6030419C18Rik 0.122 R1234 G1 101 N 9 58499432 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 01/29/2014
19 163221 UTSW 6030419C18Rik 0.122 R1385 G1 105 N 9 58499432 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 03/17/2014
20 307546 UTSW 6030419C18Rik 0.122 R3943 G1 124 Y 9 58499432 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 04/17/2015
21 344954 UTSW 6030419C18Rik 0.122 R4614 G1 105 Y 9 58499432 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 09/25/2015
22 151886 UTSW 9530077C05Rik 0.178 R1239 G1 217 Y 9 22424699 GTTCTTC GTTC small deletion Het probably benign 0.056 01/29/2014
23 62139 UTSW A230050P20Rik 0.233 R0669 G1 104 N 9 20873717 AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA small deletion Het probably benign 07/30/2013
24 169187 UTSW A230050P20Rik 0.233 R1500 G1 106 N 9 20873717 AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA small deletion Het probably benign 04/13/2014
25 265129 UTSW A230050P20Rik 0.233 R3055 G1 108 N 9 20873717 AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA small deletion Het probably benign 02/05/2015
26 519124 UTSW A430033K04Rik 0.155 R6444 G1 217.47 Y 5 138639569 ACAGAGCAGTGCCTACCAG ACAG small deletion Het probably benign 05/24/2018
27 511191 UTSW A530064D06Rik 0.000 FR4340 214.46 N 17 48163381 GTAGGAAGCTTAG GTAG small deletion Homo probably benign 04/05/2018
28 511426 UTSW A530064D06Rik 0.000 FR4589 214.46 N 17 48163381 GTAGGAAGCTTAG GTAG small deletion Homo probably benign 04/05/2018
29 511571 UTSW A630001G21Rik 0.075 FR4737 130.46 N 1 85723135 CTGTT CT small deletion Homo probably benign 04/05/2018
30 272528 UTSW A630073D07Rik 0.139 R3791 G1 111 N 6 132626516 AGGTGGTGGTGGTGGTGGTGGTGG AGGTGGTGGTGGTGGTGGTGG small deletion Het probably benign 03/25/2015
31 197497 UTSW Aak1 0.288 Y4335 102 N 6 86959142 ACAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAGC small deletion Het probably benign phenotype 05/23/2014
32 152561 UTSW Abcb10 1.000 V7581 152 N stinger 8 123969761 GGCCATCG GG small deletion Het probably benign phenotype 01/29/2014
33 511627 UTSW Abcb4 0.000 FR4737 172.46 N 5 8896597 GAAA G small deletion Homo probably benign phenotype 04/05/2018
34 512101 UTSW Abt1 0.966 FR4548 167.47 N 13 23423711 TTCTTGCT TT small deletion Het probably benign phenotype 04/05/2018
35 511928 UTSW Abt1 0.966 FR4976 115.47 N 13 23423711 TTCTTGCT TT small deletion Het probably benign phenotype 04/05/2018
36 66949 UTSW Acbd3 0.367 R0524 G1 106 N 1 180747059 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA small deletion Het probably benign phenotype 08/19/2013
37 80999 UTSW Acbd3 0.367 R0884 G1 185 N 1 180747059 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA small deletion Het probably benign phenotype 11/07/2013
38 81607 UTSW Adgrb2 0.000 R0965 G1 112 N 4 129992416 AGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGG small deletion Het probably benign phenotype 11/08/2013
39 519907 UTSW Adgrb2 0.000 R6511 G1 119.47 N 4 129992416 AGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGG small deletion Het probably benign phenotype 06/06/2018
40 240955 UTSW AI593442 0.207 R2248 G1 138 N 9 52677814 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA small deletion Het probably benign 10/15/2014
41 387126 UTSW AI593442 0.207 R5081 G1 133 N 9 52677814 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA small deletion Het probably benign 06/06/2016
42 515615 UTSW Ak6 0.941 R6386 G1 217.47 N 13 100655803 TGACGA TGA small deletion Het probably benign phenotype 05/04/2018
43 95062 UTSW Ak7 0.193 R1028 G1 127 N 12 105710189 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA small deletion Het probably benign phenotype 01/05/2014
44 208442 UTSW Akp3 0.286 R1864 G1 102 N 1 87127767 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC small deletion Het probably benign phenotype 06/30/2014
45 434793 UTSW Amer2 0.205 R5535 G1 103 N 14 60378853 AAGGAGGAGGAGGAG AAGGAGGAGGAG small deletion Het probably benign 10/24/2016
46 511792 UTSW Anapc2 1.000 FR4976 217.47 N 2 25272532 TGGCGGTGGCGGCGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGG small deletion Het probably benign phenotype 04/05/2018
47 524457 UTSW Anapc2 1.000 R6587 G1 166.47 N 2 25272538 TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG small deletion Het probably benign phenotype 06/22/2018
48 95048 UTSW Ano8 0.285 R1028 G1 104 N 8 71480971 GCCTCCTCCTCCTCCTC GCCTCCTCCTCCTC small deletion Het probably benign 01/05/2014
49 501296 UTSW Ap1s1 0.217 R5690 G1 115 N 5 137037379 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC small deletion Het probably benign phenotype 12/01/2017
50 262370 UTSW Arhgap28 0.198 R0811 G1 120 N 17 67901299 TCAGCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAGCAG small deletion Het probably benign phenotype 02/04/2015
51 500780 UTSW Arhgef10l 0.282 R3732 G1 108 N 4 140581619 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA small deletion Het probably benign phenotype 12/01/2017
52 451402 UTSW Arhgef10l 0.282 R5720 G1 135 N 4 140581619 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA small deletion Het probably benign phenotype 01/03/2017
53 162533 UTSW Arhgef17 0.780 R1389 G1 110 N 7 100931037 TGGAGGAGGAGGAGGAGG TGGAGGAGGAGGAGG small deletion Het probably benign 03/17/2014
54 389375 UTSW Arih2 1.000 R5033 G1 217 N 9 108611660 AGCCG AG small deletion Het probably benign phenotype 06/06/2016
55 368164 UTSW Atoh7 0.538 R4779 G1 217 Y 10 63100408 ATGGCGCT AT small deletion Het probably benign phenotype 12/29/2015
56 329046 UTSW Atp10a 0.539 R4453 G1 167 N 7 58658500 TGGCGGCGGC TGGCGGC small deletion Het probably benign p23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators] (source: MGI)">phenotype 07/21/2015
57 352851 UTSW Atp10a 0.539 R4661 G1 217 N 7 58658500 TGGCGGCGGC TGGCGGC small deletion Het probably benign p23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators] (source: MGI)">phenotype 10/08/2015
58 167236 UTSW Atp2b3 0.101 R1518 G1 214 N X 73545123 GACAACA GACA small deletion Het probably benign phenotype 04/13/2014
59 94723 UTSW Atxn2l 0.771 R1132 G1 110 N 7 126494248 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC small deletion Het probably benign phenotype 01/05/2014
60 517567 UTSW Atxn2l 0.771 R6460 G1 136.47 N 7 126494248 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC small deletion Het probably benign phenotype 05/21/2018
61 523869 UTSW Atxn2l 0.771 R6578 G1 100.47 N 7 126494248 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC small deletion Het probably benign phenotype 06/22/2018
62 537253 UTSW AU015836 0.366 R6891 G1 116.47 N X 93969111 TGAGGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGA small deletion Het probably benign 10/18/2018
63 486101 UTSW Baz2a 0.501 R6088 G1 217.47 Y 10 128114642 TCTCCTC TCTC small deletion Het probably benign 08/16/2017
64 484669 UTSW Baz2a 0.501 R6089 G1 217.47 N 10 128114642 TCTCCTC TCTC small deletion Het probably benign 08/16/2017
65 476697 UTSW BC024139 0.066 R2697 G1 152 N 15 76120193 TCCACCACCACCACCACCAC TCCACCACCACCACCAC small deletion Het probably benign 05/15/2017
66 276068 UTSW Bend3 0.487 R3854 G1 146 Y 10 43510717 AAGGACCA AA small deletion Het probably benign 04/06/2015
67 315084 UTSW Blm 1.000 R4155 G1 127 N 7 80512904 GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC small deletion Het probably benign phenotype 05/14/2015
68 489970 UTSW Blm 1.000 R6163 G1 102.47 N 7 80512904 GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC small deletion Het probably benign phenotype 10/10/2017
69 519192 UTSW Blm 1.000 R6446 G1 111.47 N 7 80512904 GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC small deletion Het probably benign phenotype 05/24/2018
70 511891 UTSW Bmp5 0.468 FR4976 216.23 N 9 75776375 GAGGAGT G small deletion Homo probably benign phenotype 04/05/2018
71 262446 UTSW Bmp6 0.000 R1218 G1 116 N 13 38346250 ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG small deletion Het probably benign phenotype 02/04/2015
72 101591 UTSW Brd2 1.000 R1150 G1 217 N 17 34114007 ATCTTCTTC ATCTTC small deletion Het probably benign 0.081 phenotype 01/15/2014
73 101625 UTSW Brd2 1.000 R1152 G1 217 N 17 34114007 ATCTTCTTC ATCTTC small deletion Het probably benign 0.081 phenotype 01/15/2014
74 162265 UTSW Brd2 1.000 R1426 G1 217 Y 17 34114007 ATCTTCTTC ATCTTC small deletion Het probably benign 0.081 phenotype 03/14/2014
75 202034 UTSW Brdt 0.000 R1794 G1 111 N 5 107359853 ACAGCAGCAGCAGCAGC ACAGCAGCAGCAGC small deletion Het probably benign phenotype 06/23/2014
76 402509 UTSW Btbd11 0.276 R5224 G1 217 Y 10 85645522 CGTGACCTTTCTGGT CGT small deletion Het probably benign 0.064 07/22/2016
77 528611 UTSW C2cd6 0.065 R6697 G1 217.47 N 1 59051088 ATGTGGCCTGTCTTCT A small deletion Het probably benign 07/24/2018
78 322039 UTSW Carmil3 0.268 R4285 G1 217 Y 14 55499476 GGACGA GGA small deletion Het probably benign 0.064 06/20/2015
79 332032 UTSW Carmil3 0.268 R4506 G1 217 Y 14 55499476 GGACGA GGA small deletion Het probably benign 0.064 07/21/2015
80 332069 UTSW Carmil3 0.268 R4507 G1 217 Y 14 55499476 GGACGA GGA small deletion Het probably benign 0.064 07/21/2015
81 333259 UTSW Carmil3 0.268 R4534 G1 217 N 14 55499476 GGACGA GGA small deletion Het probably benign 0.064 08/18/2015
82 333301 UTSW Carmil3 0.268 R4535 G1 217 N 14 55499476 GGACGA GGA small deletion Het probably benign 0.064 08/18/2015
83 342352 UTSW Carmil3 0.268 R4574 G1 217 Y 14 55499476 GGACGA GGA small deletion Het probably benign 0.064 09/24/2015
84 433735 UTSW Casc4 0.195 R5533 G1 217 N 2 121925697 AGATGGTGATGGTG AGATGGTG small deletion Het probably benign phenotype 10/06/2016
85 511111 UTSW Casz1 0.466 FR4340 138.72 N 4 148952302 ACCACAGCCACAGCCACAGCCAC ACCACAGCCACAGCCAC small deletion Homo probably benign phenotype 04/05/2018
86 67027 UTSW Casz1 0.466 R0550 G1 105 Y 4 148952284 GCCACCACCACCACCACCACCAC GCCACCACCACCACCACCAC small deletion Het probably benign 0.070 phenotype 08/20/2013
87 445312 UTSW Cbarp 0.167 R5761 G1 112 Y 10 80132233 CGCCTCTGCTGCCTCT CGCCTCT small deletion Het probably benign 11/21/2016
88 228054 UTSW Ccdc27 0.028 R2131 G1 128 N 4 154036306 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC small deletion Het probably benign 09/17/2014
89 319813 UTSW Ccdc27 0.028 R4183 G1 148 N 4 154036306 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC small deletion Het probably benign 06/10/2015
90 308560 UTSW Ccdc6 0.143 R3933 G1 217 Y 10 70189170 TCCGCCGCCGCC TCCGCCGCC small deletion Het probably benign 0.129 phenotype 04/17/2015
91 510957 UTSW Ccdc73 0.190 FR4304 182.46 N 2 104991840 TAAG T small deletion Homo probably benign 04/05/2018
92 511577 UTSW Ccdc73 0.190 FR4737 185.46 N 2 104991840 TAAG T small deletion Homo probably benign 04/05/2018
93 325676 UTSW Ccer1 0.047 R4364 G1 121 N 10 97694370 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA small deletion Het probably benign 07/06/2015
94 512058 UTSW Cckbr 0.048 FR4548 146.51 N 7 105434681 GGGC G small deletion Homo probably benign phenotype 04/05/2018
95 511525 UTSW Ccnk 1.000 FR4449 217.47 N 12 108202507 TTCCCAC T small deletion Het probably benign phenotype 04/05/2018
96 511717 UTSW Ccnk 1.000 FR4737 217.47 N 12 108202507 TTCCCAC T small deletion Het probably benign phenotype 04/05/2018
97 511923 UTSW Ccnk 1.000 FR4976 217.47 N 12 108202507 TTCCCAC T small deletion Het probably benign phenotype 04/05/2018
98 512049 UTSW Cd3eap 0.796 FR4548 130.46 N 7 19357244 GGATG GG small deletion Homo probably benign 04/05/2018
99 156352 UTSW Cdc14a 0.290 R1363 G1 101 N 3 116293860 CGCTGCTGCTGCTGCTGCTG CGCTGCTGCTGCTGCTG small deletion Het probably benign phenotype 02/11/2014
100 348832 UTSW Cdca7 0.313 R4627 G1 161 N 2 72481861 TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA small deletion Het probably benign phenotype 10/08/2015
[records 1 to 100 of 847] next >> last >|