Incidental Mutations

585 incidental mutations are currently displayed, and affect 300 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
585 are Probably Benign.
0 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 585] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 66158 UTSW 1110002E22Rik 0.194 R0239 G1 153 N 3 138065834 TTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCC small deletion Het probably benign 08/19/2013
2 66840 UTSW 1700016K19Rik 0.047 R0025 G1 109 N 11 76000115 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 08/19/2013
3 535605 UTSW 1700021F05Rik 0.291 R6850 G1 217.47 N 10 43532725 ACTGCACCACCT ACT small deletion Het probably benign 09/12/2018
4 535932 UTSW 1700021F05Rik 0.291 R6866 G1 217.47 N 10 43532725 ACTGCACCACCT ACT small deletion Het probably benign 10/18/2018
5 535983 UTSW 1700021F05Rik 0.291 R6867 G1 217.47 N 10 43532725 ACTGCACCACCT ACT small deletion Het probably benign 10/18/2018
6 270815 UTSW 4930402K13Rik 0.026 R3726 G1 214 Y X 9105103 AGAGGAG AGAG small deletion Het probably benign 03/18/2015
7 511007 UTSW 4930433I11Rik 0.087 FR4304 217.47 N 7 40993056 ACCTC AC small deletion Het probably benign 04/05/2018
8 511129 UTSW 4930433I11Rik 0.087 FR4340 217.47 N 7 40993055 AACC A small deletion Het probably benign 04/05/2018
9 511245 UTSW 4930433I11Rik 0.087 FR4342 186.47 N 7 40993055 AACC A small deletion Het probably benign 04/05/2018
10 512052 UTSW 4930433I11Rik 0.087 FR4548 217.47 N 7 40993056 ACCTC AC small deletion Het probably benign 04/05/2018
11 511032 UTSW 4930447C04Rik 0.288 FR4304 105.46 N 12 72881287 AAGT A small deletion Homo probably benign phenotype 04/05/2018
12 510989 UTSW 4930548H24Rik 0.084 FR4304 214.46 N 5 31487373 GAGAAG GAG small deletion Homo probably benign 04/05/2018
13 511114 UTSW 4930548H24Rik 0.084 FR4340 217.47 N 5 31487373 GAGAAG GAG small deletion Het probably benign 04/05/2018
14 511231 UTSW 4930548H24Rik 0.084 FR4342 214.46 N 5 31487373 GAGAAG GAG small deletion Homo probably benign 04/05/2018
15 511339 UTSW 4930548H24Rik 0.084 FR4589 217.47 N 5 31487373 GAGAAG GAG small deletion Het probably benign 04/05/2018
16 478031 UTSW 4930548H24Rik 0.084 LCD18 G1 999 Y 5 31487373 GAGAAG GAG small deletion Het probably benign 05/17/2017
17 511690 UTSW 4932415D10Rik 0.130 FR4737 134.46 N 10 82285469 TTCA T small deletion Homo probably benign 04/05/2018
18 152388 UTSW 6030419C18Rik 0.117 R1234 G1 101 N 9 58499432 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 01/29/2014
19 163221 UTSW 6030419C18Rik 0.117 R1385 G1 105 N 9 58499432 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 03/17/2014
20 307546 UTSW 6030419C18Rik 0.117 R3943 G1 124 Y 9 58499432 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 04/17/2015
21 344954 UTSW 6030419C18Rik 0.117 R4614 G1 105 Y 9 58499432 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 09/25/2015
22 62139 UTSW A230050P20Rik 0.277 R0669 G1 104 N 9 20873717 AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA small deletion Het probably benign 07/30/2013
23 169187 UTSW A230050P20Rik 0.277 R1500 G1 106 N 9 20873717 AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA small deletion Het probably benign 04/13/2014
24 265129 UTSW A230050P20Rik 0.277 R3055 G1 108 N 9 20873717 AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA small deletion Het probably benign 02/05/2015
25 519124 UTSW A430033K04Rik 0.157 R6444 G1 217.47 Y 5 138639569 ACAGAGCAGTGCCTACCAG ACAG small deletion Het probably benign 05/24/2018
26 511191 UTSW A530064D06Rik 0.000 FR4340 214.46 N 17 48163381 GTAGGAAGCTTAG GTAG small deletion Homo probably benign 04/05/2018
27 511426 UTSW A530064D06Rik 0.000 FR4589 214.46 N 17 48163381 GTAGGAAGCTTAG GTAG small deletion Homo probably benign 04/05/2018
28 272528 UTSW A630073D07Rik 0.156 R3791 G1 111 N 6 132626516 AGGTGGTGGTGGTGGTGGTGGTGG AGGTGGTGGTGGTGGTGGTGG small deletion Het probably benign 03/25/2015
29 197497 UTSW Aak1 0.243 Y4335 102 N 6 86959142 ACAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAGC small deletion Het probably benign phenotype 05/23/2014
30 511627 UTSW Abcb4 0.000 FR4737 172.46 N 5 8896597 GAAA G small deletion Homo probably benign phenotype 04/05/2018
31 512101 UTSW Abt1 0.967 FR4548 167.47 N 13 23423711 TTCTTGCT TT small deletion Het probably benign phenotype 04/05/2018
32 511928 UTSW Abt1 0.967 FR4976 115.47 N 13 23423711 TTCTTGCT TT small deletion Het probably benign phenotype 04/05/2018
33 66949 UTSW Acbd3 0.407 R0524 G1 106 N 1 180747059 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA small deletion Het probably benign phenotype 08/19/2013
34 80999 UTSW Acbd3 0.407 R0884 G1 185 N 1 180747059 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA small deletion Het probably benign phenotype 11/07/2013
35 81607 UTSW Adgrb2 0.000 R0965 G1 112 N 4 129992416 AGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGG small deletion Het probably benign phenotype 11/08/2013
36 240955 UTSW AI593442 0.148 R2248 G1 138 N 9 52677814 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA small deletion Het probably benign 10/15/2014
37 387126 UTSW AI593442 0.148 R5081 G1 133 N 9 52677814 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA small deletion Het probably benign 06/06/2016
38 95062 UTSW Ak7 0.000 R1028 G1 127 N 12 105710189 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA small deletion Het probably benign phenotype 01/05/2014
39 208442 UTSW Akp3 0.294 R1864 G1 102 N 1 87127767 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC small deletion Het probably benign phenotype 06/30/2014
40 434793 UTSW Amer2 0.267 R5535 G1 103 N 14 60378853 AAGGAGGAGGAGGAG AAGGAGGAGGAG small deletion Het probably benign 10/24/2016
41 95048 UTSW Ano8 0.305 R1028 G1 104 N 8 71480971 GCCTCCTCCTCCTCCTC GCCTCCTCCTCCTC small deletion Het probably benign 01/05/2014
42 262370 UTSW Arhgap28 0.215 R0811 G1 120 N 17 67901299 TCAGCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAGCAG small deletion Het probably benign phenotype 02/04/2015
43 539874 UTSW Arhgap28 0.215 R6928 G1 108.47 N 17 67901299 TCAGCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAGCAG small deletion Het probably benign phenotype 11/06/2018
44 500780 UTSW Arhgef10l 0.360 R3732 G1 108 N 4 140581619 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA small deletion Het probably benign phenotype 12/01/2017
45 451402 UTSW Arhgef10l 0.360 R5720 G1 135 N 4 140581619 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA small deletion Het probably benign phenotype 01/03/2017
46 162533 UTSW Arhgef17 0.761 R1389 G1 110 N 7 100931037 TGGAGGAGGAGGAGGAGG TGGAGGAGGAGGAGG small deletion Het probably benign 03/17/2014
47 368164 UTSW Atoh7 0.637 R4779 G1 217 Y 10 63100408 ATGGCGCT AT small deletion Het probably benign phenotype 12/29/2015
48 329046 UTSW Atp10a 0.448 R4453 G1 167 N 7 58658500 TGGCGGCGGC TGGCGGC small deletion Het probably benign p23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators] (source: MGI)">phenotype 07/21/2015
49 352851 UTSW Atp10a 0.448 R4661 G1 217 N 7 58658500 TGGCGGCGGC TGGCGGC small deletion Het probably benign p23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators] (source: MGI)">phenotype 10/08/2015
50 167236 UTSW Atp2b3 0.122 R1518 G1 214 N X 73545123 GACAACA GACA small deletion Het probably benign phenotype 04/13/2014
51 94723 UTSW Atxn2l 0.768 R1132 G1 110 N 7 126494248 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC small deletion Het probably benign phenotype 01/05/2014
52 517567 UTSW Atxn2l 0.768 R6460 G1 136.47 N 7 126494248 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC small deletion Het probably benign phenotype 05/21/2018
53 523869 UTSW Atxn2l 0.768 R6578 G1 100.47 N 7 126494248 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC small deletion Het probably benign phenotype 06/22/2018
54 537253 UTSW AU015836 0.373 R6891 G1 116.47 N X 93969111 TGAGGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGA small deletion Het probably benign 10/18/2018
55 486101 UTSW Baz2a 0.466 R6088 G1 217.47 Y 10 128114642 TCTCCTC TCTC small deletion Het probably benign 08/16/2017
56 484669 UTSW Baz2a 0.466 R6089 G1 217.47 N 10 128114642 TCTCCTC TCTC small deletion Het probably benign 08/16/2017
57 315084 UTSW Blm 1.000 R4155 G1 127 N 7 80512904 GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC small deletion Het probably benign phenotype 05/14/2015
58 489970 UTSW Blm 1.000 R6163 G1 102.47 N 7 80512904 GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC small deletion Het probably benign phenotype 10/10/2017
59 519192 UTSW Blm 1.000 R6446 G1 111.47 N 7 80512904 GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC small deletion Het probably benign phenotype 05/24/2018
60 511891 UTSW Bmp5 0.549 FR4976 216.23 N 9 75776375 GAGGAGT G small deletion Homo probably benign phenotype 04/05/2018
61 262446 UTSW Bmp6 0.000 R1218 G1 116 N 13 38346250 ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG small deletion Het probably benign phenotype 02/04/2015
62 202034 UTSW Brdt 0.000 R1794 G1 111 N 5 107359853 ACAGCAGCAGCAGCAGC ACAGCAGCAGCAGC small deletion Het probably benign phenotype 06/23/2014
63 402509 UTSW Btbd11 0.252 R5224 G1 217 Y 10 85645522 CGTGACCTTTCTGGT CGT small deletion Het probably benign 0.064 07/22/2016
64 528611 UTSW C2cd6 0.027 R6697 G1 217.47 N 1 59051088 ATGTGGCCTGTCTTCT A small deletion Het probably benign 07/24/2018
65 511111 UTSW Casz1 0.387 FR4340 138.72 N 4 148952302 ACCACAGCCACAGCCACAGCCAC ACCACAGCCACAGCCAC small deletion Homo probably benign phenotype 04/05/2018
66 67027 UTSW Casz1 0.387 R0550 G1 105 Y 4 148952284 GCCACCACCACCACCACCACCAC GCCACCACCACCACCACCAC small deletion Het probably benign 0.070 phenotype 08/20/2013
67 228054 UTSW Ccdc27 0.028 R2131 G1 128 N 4 154036306 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC small deletion Het probably benign 09/17/2014
68 319813 UTSW Ccdc27 0.028 R4183 G1 148 N 4 154036306 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC small deletion Het probably benign 06/10/2015
69 325676 UTSW Ccer1 0.043 R4364 G1 121 N 10 97694370 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA small deletion Het probably benign 07/06/2015
70 512058 UTSW Cckbr 0.069 FR4548 146.51 N 7 105434681 GGGC G small deletion Homo probably benign phenotype 04/05/2018
71 156352 UTSW Cdc14a 0.288 R1363 G1 101 N 3 116293860 CGCTGCTGCTGCTGCTGCTG CGCTGCTGCTGCTGCTG small deletion Het probably benign phenotype 02/11/2014
72 348832 UTSW Cdca7 0.285 R4627 G1 161 N 2 72481861 TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA small deletion Het probably benign phenotype 10/08/2015
73 378083 UTSW Cdca7 0.285 R4905 G1 121 N 2 72481861 TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA small deletion Het probably benign phenotype 04/15/2016
74 61387 UTSW Celf3 0.245 R0670 G1 107 N 3 94488230 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA small deletion Het probably benign phenotype 07/30/2013
75 254446 UTSW Celf3 0.245 R2566 G1 140 N 3 94488230 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA small deletion Het probably benign phenotype 12/04/2014
76 382890 UTSW Celf3 0.245 R4939 G1 122 N 3 94488230 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA small deletion Het probably benign phenotype 04/27/2016
77 398090 UTSW Cep135 0.805 R5233 G1 217 Y 5 76591843 AGTCTGCCTTTGG A small deletion Het probably benign phenotype 07/06/2016
78 385265 UTSW Cgnl1 0.215 R4996 G1 217 N 9 71724826 CTTGCCCAGGTT CTT small deletion Het probably benign phenotype 05/10/2016
79 501763 UTSW Chd5 0.000 R6039 G1 103.47 N 4 152353621 CAAGAAGAAGAAGAAGAA CAAGAAGAAGAAGAA small deletion Het probably benign phenotype 12/01/2017
80 265791 UTSW Chd6 0.508 R3025 G1 213 N 2 160966552 GATCAT GAT small deletion Het probably benign phenotype 02/05/2015
81 268860 UTSW Cherp 0.956 R3693 G1 106 Y 8 72467911 TTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTG small deletion Het probably benign 02/19/2015
82 444689 UTSW Cherp 0.956 R5739 G1 217 Y 8 72467815 TGCTGGTGGTGGGG TG small deletion Het probably benign 11/21/2016
83 262118 UTSW Cherp 0.956 T0722 G3 217 N 711 8 72462034 TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA small deletion Het probably benign 02/04/2015
84 262162 UTSW Cherp 0.956 T0975 G3 154 N 714 8 72462034 TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA small deletion Het probably benign 02/04/2015
85 353098 UTSW Cic 0.752 R4664 G1 217 Y 7 25290674 TGTTGCCCTC T small deletion Het probably benign phenotype 10/08/2015
86 157943 UTSW Ckb 0.000 R1311 G1 128 Y 12 111669645 TCCACCACCA TCCACCA small deletion Het probably benign 0.062 phenotype 02/18/2014
87 308201 UTSW Ckb 0.000 R1888 G1 217 Y 12 111669645 TCCACCACCA TCCACCA small deletion Het probably benign 0.062 phenotype 04/17/2015
88 211525 UTSW Ckb 0.000 R1891 G1 215 N 12 111669645 TCCACCACCA TCCACCA small deletion Het probably benign 0.062 phenotype 06/30/2014
89 314704 UTSW Cmtm1 0.405 R4132 G1 146 N 8 104309470 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT small deletion Het probably benign 05/14/2015
90 345029 UTSW Cmtm1 0.405 R4615 G1 146 N 8 104309470 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT small deletion Het probably benign 09/25/2015
91 404006 UTSW Cmtm1 0.405 R5277 G1 121 Y 8 104309470 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT small deletion Het probably benign 07/22/2016
92 422681 UTSW Cmtm1 0.405 R5347 G1 128 N 8 104309470 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT small deletion Het probably benign 08/04/2016
93 423021 UTSW Cmtm1 0.405 R5364 G1 102 Y 8 104309470 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT small deletion Het probably benign 08/04/2016
94 426051 UTSW Cmtm1 0.405 R5394 G1 137 Y 8 104309470 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT small deletion Het probably benign 08/04/2016
95 430110 UTSW Cmtm1 0.405 R5403 G1 157 N 8 104309470 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT small deletion Het probably benign 09/06/2016
96 438032 UTSW Cmtm1 0.405 R5611 G1 123 N 8 104309470 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT small deletion Het probably benign 10/26/2016
97 451115 UTSW Cmtm1 0.405 R5715 G1 167 N 8 104309470 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT small deletion Het probably benign 01/03/2017
98 452766 UTSW Cmtm1 0.405 R5731 G1 116 N 8 104309470 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT small deletion Het probably benign 01/03/2017
99 503202 UTSW Cmtm1 0.405 R6207 G1 112.47 N 8 104309470 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT small deletion Homo probably benign 02/27/2018
100 522679 UTSW Cmtm1 0.405 R6566 G1 138.49 N 8 104309470 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT small deletion Homo probably benign 06/06/2018
[records 1 to 100 of 585] next >> last >|