Incidental Mutations

670 incidental mutations are currently displayed, and affect 336 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
667 are Probably Benign.
0 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 670] next >> last >| per page Full List
ID question?
Source question?
Gene question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
MGI Phenotype question?
Posted question?
1 66158 UTSW 1110002E22Rik R0239 G1 153 N 3 138065834 TTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCC small deletion Het probably benign 08/19/2013
2 66840 UTSW 1700016K19Rik R0025 G1 109 N 11 76000115 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 08/19/2013
3 270815 UTSW 4930402K13Rik R3726 G1 214 Y X 9105103 AGAGGAG AGAG small deletion Het probably benign 03/18/2015
4 478031 UTSW 4930548H24Rik LCD18 G1 999 Y 5 31487373 GAGAAG GAG small deletion Het probably benign 05/17/2017
5 152388 UTSW 6030419C18Rik R1234 G1 101 N 9 58499432 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 01/29/2014
6 163221 UTSW 6030419C18Rik R1385 G1 105 N 9 58499432 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 03/17/2014
7 307546 UTSW 6030419C18Rik R3943 G1 124 Y 9 58499432 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 04/17/2015
8 344954 UTSW 6030419C18Rik R4614 G1 105 Y 9 58499432 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 09/25/2015
9 151886 UTSW 9530077C05Rik R1239 G1 217 Y 9 22424699 GTTCTTC GTTC small deletion Het probably benign 01/29/2014
10 62139 UTSW A230050P20Rik R0669 G1 104 N 9 20873717 AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA small deletion Het probably benign 07/30/2013
11 169187 UTSW A230050P20Rik R1500 G1 106 N 9 20873717 AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA small deletion Het probably benign 04/13/2014
12 265129 UTSW A230050P20Rik R3055 G1 108 N 9 20873717 AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA small deletion Het probably benign 02/05/2015
13 272528 UTSW A630073D07Rik R3791 G1 111 N 6 132626516 AGGTGGTGGTGGTGGTGGTGGTGG AGGTGGTGGTGGTGGTGGTGG small deletion Het probably benign 03/25/2015
14 197497 UTSW Aak1 Y4335 102 N 6 86959142 ACAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAGC small deletion Het probably benign 05/23/2014
15 152561 UTSW Abcb10 V7581 152 N stinger 8 123969761 GGCCATCG GG small deletion Het probably benign phenotype 01/29/2014
16 66949 UTSW Acbd3 R0524 G1 106 N 1 180747059 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA small deletion Het probably benign 08/19/2013
17 80999 UTSW Acbd3 R0884 G1 185 N 1 180747059 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA small deletion Het probably benign 11/07/2013
18 81607 UTSW Adgrb2 R0965 G1 112 N 4 129992416 AGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGG small deletion Het probably benign phenotype 11/08/2013
19 240955 UTSW AI593442 R2248 G1 138 N 9 52677814 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA small deletion Het probably benign 10/15/2014
20 387126 UTSW AI593442 R5081 G1 133 N 9 52677814 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA small deletion Het probably benign 06/06/2016
21 66504 UTSW Aim1l R0414 G1 217 Y 4 134072636 GAGAAGAAG GAGAAG small deletion Het probably benign 08/19/2013
22 61159 UTSW Aim1l R0686 G1 107 N 4 134074526 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG small deletion Het probably benign 07/30/2013
23 239589 UTSW Aim1l R2229 G1 114 Y 4 134074526 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG small deletion Het probably benign 10/15/2014
24 471749 UTSW Aim1l R5976 G1 116 N 4 134074526 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG small deletion Het probably benign 03/31/2017
25 95062 UTSW Ak7 R1028 G1 127 N 12 105710189 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA small deletion Het probably benign phenotype 01/05/2014
26 208442 UTSW Akp3 R1864 G1 102 N 1 87127767 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC small deletion Het probably benign phenotype 06/30/2014
27 434793 UTSW Amer2 R5535 G1 103 N 14 60378853 AAGGAGGAGGAGGAG AAGGAGGAGGAG small deletion Het probably benign 10/24/2016
28 95048 UTSW Ano8 R1028 G1 104 N 8 71480971 GCCTCCTCCTCCTCCTC GCCTCCTCCTCCTC small deletion Het probably benign 01/05/2014
29 501296 UTSW Ap1s1 R5690 G1 115 N 5 137037379 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC small deletion Het probably benign 12/01/2017
30 262370 UTSW Arhgap28 R0811 G1 120 N 17 67901299 TCAGCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAGCAG small deletion Het probably benign 02/04/2015
31 500780 UTSW Arhgef10l R3732 G1 108 N 4 140581619 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA small deletion Het probably benign 12/01/2017
32 451402 UTSW Arhgef10l R5720 G1 135 N 4 140581619 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA small deletion Het probably benign 01/03/2017
33 162533 UTSW Arhgef17 R1389 G1 110 N 7 100931037 TGGAGGAGGAGGAGGAGG TGGAGGAGGAGGAGG small deletion Het probably benign 03/17/2014
34 389375 UTSW Arih2 R5033 G1 217 N 9 108611660 AGCCG AG small deletion Het probably benign phenotype 06/06/2016
35 368164 UTSW Atoh7 R4779 G1 217 Y 10 63100408 ATGGCGCT AT small deletion Het probably benign phenotype 12/29/2015
36 329046 UTSW Atp10a R4453 G1 167 N 7 58658500 TGGCGGCGGC TGGCGGC small deletion Het probably benign phenotype 07/21/2015
37 352851 UTSW Atp10a R4661 G1 217 N 7 58658500 TGGCGGCGGC TGGCGGC small deletion Het probably benign phenotype 10/08/2015
38 167236 UTSW Atp2b3 R1518 G1 214 N X 73545123 GACAACA GACA small deletion Het probably benign 04/13/2014
39 94723 UTSW Atxn2l R1132 G1 110 N 7 126494248 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC small deletion Het probably benign 01/05/2014
40 486101 UTSW Baz2a R6088 G1 217.47 N 10 128114642 TCTCCTC TCTC small deletion Het probably benign 08/16/2017
41 484669 UTSW Baz2a R6089 G1 217.47 N 10 128114642 TCTCCTC TCTC small deletion Het probably benign 08/16/2017
42 476697 UTSW BC024139 R2697 G1 152 N 15 76120193 TCCACCACCACCACCACCAC TCCACCACCACCACCAC small deletion Het probably benign 05/15/2017
43 482581 UTSW BC051019 R6073 G1 124.47 N 7 109716030 AGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAG small deletion Het probably benign 07/14/2017
44 276068 UTSW Bend3 R3854 G1 146 Y 10 43510717 AAGGACCA AA small deletion Het probably benign 04/06/2015
45 315084 UTSW Blm R4155 G1 127 N 7 80512904 GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC small deletion Het probably benign phenotype 05/14/2015
46 489970 UTSW Blm R6163 G1 102.47 N 7 80512904 GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC small deletion Het probably benign phenotype 10/10/2017
47 262446 UTSW Bmp6 R1218 G1 116 N 13 38346250 ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG small deletion Het probably benign phenotype 02/04/2015
48 101591 UTSW Brd2 R1150 G1 217 N 17 34114007 ATCTTCTTC ATCTTC small deletion Het probably benign phenotype 01/15/2014
49 101625 UTSW Brd2 R1152 G1 217 N 17 34114007 ATCTTCTTC ATCTTC small deletion Het probably benign phenotype 01/15/2014
50 162265 UTSW Brd2 R1426 G1 217 Y 17 34114007 ATCTTCTTC ATCTTC small deletion Het probably benign phenotype 03/14/2014
51 202034 UTSW Brdt R1794 G1 111 N 5 107359853 ACAGCAGCAGCAGCAGC ACAGCAGCAGCAGC small deletion Het probably benign phenotype 06/23/2014
52 402509 UTSW Btbd11 R5224 G1 217 Y 10 85645522 CGTGACCTTTCTGGT CGT small deletion Het probably benign 07/22/2016
53 433735 UTSW Casc4 R5533 G1 217 N 2 121925697 AGATGGTGATGGTG AGATGGTG small deletion Het probably benign 10/06/2016
54 67027 UTSW Casz1 R0550 G1 105 Y 4 148952284 GCCACCACCACCACCACCACCAC GCCACCACCACCACCACCAC small deletion Het probably benign 08/20/2013
55 445312 UTSW Cbarp R5761 G1 112 Y 10 80132233 CGCCTCTGCTGCCTCT CGCCTCT small deletion Het probably benign 11/21/2016
56 228054 UTSW Ccdc27 R2131 G1 128 N 4 154036306 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC small deletion Het probably benign 09/17/2014
57 319813 UTSW Ccdc27 R4183 G1 148 N 4 154036306 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC small deletion Het probably benign 06/10/2015
58 308560 UTSW Ccdc6 R3933 G1 217 Y 10 70189170 TCCGCCGCCGCC TCCGCCGCC small deletion Het probably benign 04/17/2015
59 325676 UTSW Ccer1 R4364 G1 121 N 10 97694370 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA small deletion Het probably benign 07/06/2015
60 156352 UTSW Cdc14a R1363 G1 101 N 3 116293860 CGCTGCTGCTGCTGCTGCTG CGCTGCTGCTGCTGCTG small deletion Het probably benign 02/11/2014
61 348832 UTSW Cdca7 R4627 G1 161 N 2 72481861 TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA small deletion Het probably benign 10/08/2015
62 378083 UTSW Cdca7 R4905 G1 121 N 2 72481861 TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA small deletion Het probably benign 04/15/2016
63 255567 UTSW Cdk11b R2922 G1 217 Y 4 155640744 CAGAAGAAG CAGAAG small deletion Het probably benign phenotype 12/29/2014
64 61387 UTSW Celf3 R0670 G1 107 N 3 94488230 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA small deletion Het probably benign phenotype 07/30/2013
65 254446 UTSW Celf3 R2566 G1 140 N 3 94488230 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA small deletion Het probably benign phenotype 12/04/2014
66 382890 UTSW Celf3 R4939 G1 122 N 3 94488230 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA small deletion Het probably benign phenotype 04/27/2016
67 398090 UTSW Cep135 R5233 G1 217 Y 5 76591843 AGTCTGCCTTTGG A small deletion Het probably benign 07/06/2016
68 437301 UTSW Cep89 R5578 G1 133 N 7 35409642 ACTCCTCCTCCTCCTCCTCCTCCTC ACTCCTCCTCCTCCTCCTCCTC small deletion Het probably benign 10/26/2016
69 385265 UTSW Cgnl1 R4996 G1 217 N 9 71724826 CTTGCCCAGGTT CTT small deletion Het probably benign 05/10/2016
70 501763 UTSW Chd5 R6039 G1 103.47 N 4 152353621 CAAGAAGAAGAAGAAGAA CAAGAAGAAGAAGAA small deletion Het probably benign phenotype 12/01/2017
71 487228 UTSW Chd5 R6133 G1 159.47 N 4 152353621 CAAGAAGAAGAAGAAGAA CAAGAAGAAGAAGAA small deletion Het probably benign phenotype 10/10/2017
72 265791 UTSW Chd6 R3025 G1 213 N 2 160966552 GATCAT GAT small deletion Het probably benign phenotype 02/05/2015
73 268860 UTSW Cherp R3693 G1 106 Y 8 72467911 TTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTG small deletion Het probably benign 02/19/2015
74 444689 UTSW Cherp R5739 G1 217 Y 8 72467815 TGCTGGTGGTGGGG TG small deletion Het probably benign 11/21/2016
75 262118 UTSW Cherp T0722 G3 217 N 711 8 72462034 TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA small deletion Het probably benign 02/04/2015
76 262162 UTSW Cherp T0975 G3 154 N 714 8 72462034 TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA small deletion Het probably benign 02/04/2015
77 353098 UTSW Cic R4664 G1 217 Y 7 25290674 TGTTGCCCTC T small deletion Het probably benign phenotype 10/08/2015
78 78606 UTSW Ciz1 R0816 G1 110 N 2 32376376 GGAAGAAGAAGAAGAAG GGAAGAAGAAGAAG small deletion Het probably benign 10/16/2013
79 157943 UTSW Ckb R1311 G1 128 Y 12 111669645 TCCACCACCA TCCACCA small deletion Het probably benign phenotype 02/18/2014
80 308201 UTSW Ckb R1888 G1 217 Y 12 111669645 TCCACCACCA TCCACCA small deletion Het probably benign phenotype 04/17/2015
81 211525 UTSW Ckb R1891 G1 215 N 12 111669645 TCCACCACCA TCCACCA small deletion Het probably benign phenotype 06/30/2014
92 83873 UTSW Cntn2 R0903 G1 124 N 1 132533684 CCAGCAGCAGCAGCAGCA CCAGCAGCAGCAGCA small deletion Het probably benign phenotype 11/08/2013
93 83838 UTSW Col4a1 R0900 G1 181 N 8 11218014 AGCCAGGGATGCCAGG AGCCAGG small deletion Het probably benign phenotype 11/08/2013
94 242645 UTSW Cpxm2 R2273 G1 103 N 7 132059852 TGCAGCAGCAGCAGCAGCAG TGCAGCAGCAGCAGCAG small deletion Het probably benign 10/16/2014
95 441839 UTSW Cpxm2 R5626 G1 113 N 7 132059852 TGCAGCAGCAGCAGCAGCAG TGCAGCAGCAGCAGCAG small deletion Het probably benign 11/08/2016
96 225622 UTSW Crebbp R2006 G1 116 N 16 4084753 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG small deletion Het probably benign phenotype 08/25/2014
97 70367 UTSW Crebzf R0752 G1 101 N 7 90443271 TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA small deletion Het probably benign 09/30/2013
98 262737 UTSW Crim1 R1266 G1 125 N 17 78200833 GGCTGCTGCTGCTGCTG GGCTGCTGCTGCTG small deletion Het probably benign phenotype 02/04/2015
99 370663 UTSW Csde1 R4806 G1 217 Y 3 103056369 TCCTCGACCT TCCT small deletion Het probably benign 02/04/2016
100 66833 UTSW Csrnp1 R0463 G1 119 N 9 119972775 CCCTCCTCCTCCTCCTCCTC CCCTCCTCCTCCTCCTC small deletion Het probably benign phenotype 08/19/2013
[records 1 to 100 of 670] next >> last >|