Incidental Mutation 'R5282:1700102P08Rik'
List |< first << previous [record 1308 of 1308]
ID402823
Institutional Source Beutler Lab
Gene Symbol 1700102P08Rik
Ensembl Gene ENSMUSG00000032611
Gene NameRIKEN cDNA 1700102P08 gene
Synonyms
MMRRC Submission 042867-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R5282 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108392805-108410934 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 108393240 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000035234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035234] [ENSMUST00000035237] [ENSMUST00000192995] [ENSMUST00000194959]
Predicted Effect probably null
Transcript: ENSMUST00000035234
AA Change: M1K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000035237
SMART Domains Protein: ENSMUSP00000035237
Gene: ENSMUSG00000032612

DomainStartEndE-ValueType
DUSP 27 125 1.39e-46 SMART
Pfam:Ubiquitin_3 139 226 6.7e-34 PFAM
low complexity region 263 286 N/A INTRINSIC
Pfam:UCH 301 919 2.2e-84 PFAM
Pfam:UCH_1 302 507 2.8e-8 PFAM
Pfam:UCH_1 605 901 1.4e-15 PFAM
low complexity region 927 938 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000192995
AA Change: M1K

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000193288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194939
Predicted Effect probably benign
Transcript: ENSMUST00000194959
SMART Domains Protein: ENSMUSP00000141368
Gene: ENSMUSG00000032612

DomainStartEndE-ValueType
DUSP 27 125 5.5e-49 SMART
Pfam:Ubiquitin_3 139 226 1.7e-30 PFAM
Pfam:UCH 254 872 7e-89 PFAM
Pfam:UCH_1 255 469 3.5e-8 PFAM
Pfam:UCH_1 566 854 2.5e-14 PFAM
low complexity region 880 891 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195351
Predicted Effect probably benign
Transcript: ENSMUST00000195608
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,880,340 L216S possibly damaging Het
4933405O20Rik G A 7: 50,599,472 E85K possibly damaging Het
Agrn A G 4: 156,173,035 F1153L probably damaging Het
Cbx8 A G 11: 119,038,916 S284P probably damaging Het
Cep128 A G 12: 91,339,119 L170P probably damaging Het
Cyp4f14 T A 17: 32,907,985 T324S probably damaging Het
Daw1 G T 1: 83,192,698 V244L probably benign Het
Eef2kmt A G 16: 5,245,358 V306A probably benign Het
Enah A T 1: 181,935,728 probably null Het
Fam171b T C 2: 83,853,605 probably null Het
Fsip2 C T 2: 82,978,581 T1748I possibly damaging Het
Gabrg2 C T 11: 41,971,732 G175D probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hmcn1 G T 1: 150,582,296 N33K probably damaging Het
Incenp T A 19: 9,878,406 E514V unknown Het
Kank3 T C 17: 33,817,943 S74P probably benign Het
Lrriq1 G T 10: 103,215,345 N515K probably benign Het
Mfsd13b G A 7: 120,991,833 D266N probably damaging Het
Neto1 T C 18: 86,404,873 Y152H probably damaging Het
Nub1 C A 5: 24,695,535 F145L probably benign Het
Nufip1 T C 14: 76,114,275 probably null Het
Pard6g T A 18: 80,079,901 V50E probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Rapgef5 A C 12: 117,739,644 N431T probably damaging Het
Rassf9 A T 10: 102,545,344 T196S probably damaging Het
Rrp12 T C 19: 41,876,590 Y764C probably benign Het
Slfn8 T C 11: 83,017,724 probably null Het
Smox T A 2: 131,521,106 V265D probably damaging Het
Sult1b1 T C 5: 87,530,651 I105V probably benign Het
Sycp2 T C 2: 178,403,761 D22G probably damaging Het
Tbck G A 3: 132,751,216 M630I possibly damaging Het
Tenm4 G C 7: 96,837,331 G965R possibly damaging Het
Trappc10 G A 10: 78,187,860 T1258I probably damaging Het
Tssk1 G A 16: 17,895,259 G303S probably benign Het
Tstd2 T C 4: 46,120,461 Y313C probably damaging Het
Usp42 G A 5: 143,721,646 T260M probably damaging Het
Wdr43 T A 17: 71,648,777 V479E probably damaging Het
Xpo7 G A 14: 70,683,731 T599I probably damaging Het
Zfp553 A G 7: 127,236,841 K523E probably benign Het
Other mutations in 1700102P08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:1700102P08Rik APN 9 108397406 missense probably damaging 1.00
R1199:1700102P08Rik UTSW 9 108393477 missense possibly damaging 0.71
R1885:1700102P08Rik UTSW 9 108393610 missense possibly damaging 0.84
R1886:1700102P08Rik UTSW 9 108393610 missense possibly damaging 0.84
R1887:1700102P08Rik UTSW 9 108393610 missense possibly damaging 0.84
R4455:1700102P08Rik UTSW 9 108397196 missense possibly damaging 0.65
R4926:1700102P08Rik UTSW 9 108395299 missense probably damaging 0.98
R5645:1700102P08Rik UTSW 9 108397204 missense probably damaging 1.00
R6318:1700102P08Rik UTSW 9 108393275 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TCTGAGAATGGCGGGTGATC -3'
(R):5'- TTCTCACTCTCAGGAGCACACG -3'

Sequencing Primer
(F):5'- CCGCCCCTCCGAGGAAAAG -3'
(R):5'- CACACGAGGCACCAGAGTATG -3'
Posted On2016-07-22