Incidental Mutation 'R5486:Acad8'
List |< first << previous [record 1308 of 1308]
ID430370
Institutional Source Beutler Lab
Gene Symbol Acad8
Ensembl Gene ENSMUSG00000031969
Gene Nameacyl-Coenzyme A dehydrogenase family, member 8
Synonyms
MMRRC Submission 043047-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R5486 (G1)
Quality Score99
Status Not validated
Chromosome9
Chromosomal Location26974135-26999566 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 26999495 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000123012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039161] [ENSMUST00000060513] [ENSMUST00000120367] [ENSMUST00000128923] [ENSMUST00000132293] [ENSMUST00000213683] [ENSMUST00000213770]
Predicted Effect probably benign
Transcript: ENSMUST00000039161
SMART Domains Protein: ENSMUSP00000037614
Gene: ENSMUSG00000035443

DomainStartEndE-ValueType
Pfam:EVE 56 220 3.7e-57 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000060513
AA Change: M1K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054370
Gene: ENSMUSG00000031969
AA Change: M1K

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 40 151 1e-28 PFAM
Pfam:Acyl-CoA_dh_M 155 207 1.8e-23 PFAM
Pfam:Acyl-CoA_dh_1 261 411 2.9e-47 PFAM
Pfam:Acyl-CoA_dh_2 276 399 1.8e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120367
AA Change: M1K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112908
Gene: ENSMUSG00000031969
AA Change: M1K

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 40 151 7.8e-29 PFAM
Pfam:Acyl-CoA_dh_M 155 249 3.7e-28 PFAM
Pfam:Acyl-CoA_dh_1 261 411 5.7e-45 PFAM
Pfam:Acyl-CoA_dh_2 276 400 2.9e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000128923
AA Change: M1K
Predicted Effect probably null
Transcript: ENSMUST00000132293
AA Change: M1K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138102
Predicted Effect probably benign
Transcript: ENSMUST00000213683
Predicted Effect probably benign
Transcript: ENSMUST00000213770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214910
Predicted Effect probably benign
Transcript: ENSMUST00000215693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217143
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA dehydrogenase family of enzymes that catalyze the dehydrogenation of acyl-CoA derivatives in the metabolism of fatty acids or branch chained amino acids. The encoded protein is a mitochondrial enzyme that functions in catabolism of the branched-chain amino acid valine. Defects in this gene are the cause of isobutyryl-CoA dehydrogenase deficiency.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit cold intolerance at young age with a progressive hepatic steatosis and abnormal mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik G T 10: 115,579,905 probably benign Het
Adam12 C A 7: 133,907,672 R786S possibly damaging Het
Add3 G A 19: 53,244,387 V604I probably benign Het
Alpk2 A T 18: 65,294,354 probably null Het
Ano3 T C 2: 110,745,870 D102G probably damaging Het
Bdp1 T C 13: 100,098,510 Y192C probably damaging Het
Bod1l A T 5: 41,807,181 D2693E possibly damaging Het
Ccdc7a T C 8: 128,985,403 N284D probably damaging Het
Clic6 A G 16: 92,529,852 probably null Het
Cln5 T C 14: 103,076,194 I294T probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Cyp2d9 T A 15: 82,452,578 W43R probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Erlec1 A T 11: 30,935,047 H413Q probably damaging Het
Fam168a T A 7: 100,834,169 M203K probably damaging Het
Fat2 A T 11: 55,253,681 S4122R probably benign Het
Fgd4 A T 16: 16,475,037 L272Q probably damaging Het
Hpcal4 A G 4: 123,190,764 K162R probably benign Het
Iars T A 13: 49,709,573 probably null Het
Lbr A G 1: 181,818,838 probably null Het
Lrp2 T C 2: 69,437,465 I4259V probably benign Het
Mcm3 C T 1: 20,814,894 G189S probably damaging Het
Nr1d2 A G 14: 18,206,860 V137A possibly damaging Het
Olfr646 C A 7: 104,106,498 T73N probably damaging Het
Olfr665 T A 7: 104,880,961 C85S probably benign Het
Olfr853 A G 9: 19,537,294 V212A probably benign Het
Pim3 T C 15: 88,863,222 V97A possibly damaging Het
Piwil2 T C 14: 70,401,431 N479S probably benign Het
Pld3 C A 7: 27,533,731 W365L probably damaging Het
Plk3 C A 4: 117,130,403 E412* probably null Het
Psmd1 A G 1: 86,137,050 I935V possibly damaging Het
Sh2b2 A G 5: 136,232,090 S91P probably benign Het
Skor2 A G 18: 76,858,700 N39S unknown Het
Slc22a22 A G 15: 57,263,451 V55A probably damaging Het
Smg7 A G 1: 152,846,176 S595P probably damaging Het
Snrnp200 C T 2: 127,233,066 P1520S possibly damaging Het
Taar7a T A 10: 23,992,458 T342S probably benign Het
Tecpr2 A T 12: 110,933,015 I606F probably benign Het
Tex19.2 A T 11: 121,117,478 M48K probably benign Het
Thoc1 A G 18: 9,992,204 T511A probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ubr5 C A 15: 38,008,739 A1077S probably benign Het
Wdr95 A T 5: 149,596,330 R571* probably null Het
Other mutations in Acad8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Acad8 APN 9 26990594 missense probably damaging 1.00
IGL01721:Acad8 APN 9 26992267 splice site probably benign
R1473:Acad8 UTSW 9 26979041 missense probably benign 0.00
R2102:Acad8 UTSW 9 26985565 nonsense probably null
R3030:Acad8 UTSW 9 26979059 missense probably benign 0.04
R4023:Acad8 UTSW 9 26979185 missense probably benign 0.02
R4276:Acad8 UTSW 9 26978449 missense probably null 0.47
R4667:Acad8 UTSW 9 26990627 missense probably damaging 1.00
R4668:Acad8 UTSW 9 26990627 missense probably damaging 1.00
R4669:Acad8 UTSW 9 26990627 missense probably damaging 1.00
R4898:Acad8 UTSW 9 26978402 missense probably damaging 1.00
R5418:Acad8 UTSW 9 26985557 missense probably damaging 1.00
R5549:Acad8 UTSW 9 26985551 missense probably damaging 1.00
R5887:Acad8 UTSW 9 26979324 splice site probably null
R5943:Acad8 UTSW 9 26999444 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAAGTGAGTCCGTCAAGGG -3'
(R):5'- TTAGTAGAAGACGCGTCTCAGAG -3'

Sequencing Primer
(F):5'- GAGAGCCACCAAAGCGCTG -3'
(R):5'- GACTACAACTCCCAGAGT -3'
Posted On2016-10-05