Incidental Mutation 'R6136:Arsj'
List |< first << previous [record 1308 of 1308]
ID488338
Institutional Source Beutler Lab
Gene Symbol Arsj
Ensembl Gene ENSMUSG00000046561
Gene Namearylsulfatase J
Synonyms9330196J05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6136 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location126363684-126440375 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 126364775 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000091511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093976]
Predicted Effect probably null
Transcript: ENSMUST00000093976
AA Change: M1T

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000091511
Gene: ENSMUSG00000046561
AA Change: M1T

DomainStartEndE-ValueType
Pfam:Sulfatase 74 388 8.4e-68 PFAM
low complexity region 554 582 N/A INTRINSIC
Meta Mutation Damage Score 0.372 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfatases (EC 3.1.5.6), such as ARSJ, hydrolyze sulfate esters from sulfated steroids, carbohydrates, proteoglycans, and glycolipids. They are involved in hormone biosynthesis, modulation of cell signaling, and degradation of macromolecules (Sardiello et al., 2005 [PubMed 16174644]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,853 S729P probably damaging Het
3100002H09Rik C A 4: 124,610,388 G124C unknown Het
3425401B19Rik A T 14: 32,662,282 D575E possibly damaging Het
Abca15 A T 7: 120,340,049 H222L possibly damaging Het
Arhgef18 T C 8: 3,454,507 V1013A probably benign Het
Atp10a A C 7: 58,828,340 Q1377P probably benign Het
Atrip T A 9: 109,071,736 E178D probably damaging Het
Chadl T C 15: 81,693,554 N625D probably benign Het
Chrng G A 1: 87,209,801 V320I probably benign Het
Cox11 T C 11: 90,644,395 L84P probably damaging Het
Dchs1 T G 7: 105,760,925 T1747P probably benign Het
Dnah12 A G 14: 26,875,270 K3529E probably damaging Het
Ecd T C 14: 20,320,791 N620S probably damaging Het
Fbn1 T A 2: 125,403,132 K278N possibly damaging Het
Fcho2 T C 13: 98,789,767 K103E probably damaging Het
Fzd7 T G 1: 59,483,260 F101V probably damaging Het
Galnt13 G T 2: 54,516,479 probably benign Het
Gif G A 19: 11,750,285 A158T probably damaging Het
Gm32647 C T 7: 94,475,732 Het
Gm5624 A T 14: 44,559,876 D152E probably benign Het
Heatr6 T A 11: 83,772,503 V664E possibly damaging Het
Hpgd A G 8: 56,294,952 D36G probably damaging Het
Ifnlr1 A G 4: 135,703,797 T199A possibly damaging Het
Kalrn T G 16: 34,357,111 D228A probably damaging Het
Miox T C 15: 89,335,321 M47T probably damaging Het
Nampt A T 12: 32,830,302 I65F probably benign Het
Ncf1 T C 5: 134,226,633 K135E probably damaging Het
Nop53 G A 7: 15,938,389 Q452* probably null Het
Olfr1037 A G 2: 86,084,901 L292S probably damaging Het
Pik3cg A G 12: 32,204,359 V543A probably benign Het
Ralgds T C 2: 28,550,565 probably null Het
Rap1a A G 3: 105,750,282 V7A probably damaging Het
Rasal1 T C 5: 120,675,478 V639A possibly damaging Het
Rassf8 A G 6: 145,815,656 N236S probably benign Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sbno1 T C 5: 124,378,491 D1272G probably benign Het
Setx A G 2: 29,148,027 D1508G probably benign Het
Slc1a1 T A 19: 28,905,410 L358Q probably damaging Het
Slc7a12 C A 3: 14,499,126 L20I probably benign Het
Spats2l C T 1: 57,902,143 T187M probably damaging Het
Specc1l A G 10: 75,246,660 D647G probably benign Het
Steap4 G A 5: 7,978,562 R380Q probably damaging Het
Syne2 A G 12: 75,905,325 S456G probably benign Het
Tfcp2 G T 15: 100,512,313 T391N probably damaging Het
Tns2 T A 15: 102,107,030 D122E probably damaging Het
Tshr A G 12: 91,538,234 M649V probably benign Het
Ubr3 A G 2: 69,993,763 T1440A probably benign Het
Urb2 A G 8: 124,030,092 D846G probably benign Het
Vmn1r202 T C 13: 22,501,462 T262A possibly damaging Het
Vmn2r61 G T 7: 42,267,031 W356L probably damaging Het
Wdr11 T A 7: 129,618,703 M605K possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Arsj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Arsj APN 3 126364945 missense probably benign 0.00
IGL01150:Arsj APN 3 126438784 missense probably benign
IGL01337:Arsj APN 3 126365114 missense probably damaging 1.00
IGL01446:Arsj APN 3 126438814 missense probably benign 0.01
IGL01484:Arsj APN 3 126365036 missense probably damaging 1.00
IGL02479:Arsj APN 3 126438939 missense possibly damaging 0.91
IGL03149:Arsj APN 3 126439404 utr 3 prime probably benign
R0552:Arsj UTSW 3 126439344 missense probably benign 0.01
R0690:Arsj UTSW 3 126438184 missense probably damaging 0.99
R1809:Arsj UTSW 3 126438295 missense possibly damaging 0.87
R1881:Arsj UTSW 3 126438837 missense probably damaging 1.00
R1940:Arsj UTSW 3 126438346 missense probably damaging 1.00
R1957:Arsj UTSW 3 126439021 missense probably benign 0.08
R2156:Arsj UTSW 3 126438688 missense probably damaging 1.00
R2969:Arsj UTSW 3 126439372 missense probably benign 0.01
R3432:Arsj UTSW 3 126364975 missense probably benign 0.00
R4623:Arsj UTSW 3 126364796 missense probably benign 0.00
R4826:Arsj UTSW 3 126438802 missense probably damaging 1.00
R4955:Arsj UTSW 3 126438540 missense probably benign 0.15
R5134:Arsj UTSW 3 126438154 missense probably benign
R5164:Arsj UTSW 3 126438159 missense probably benign 0.00
R5468:Arsj UTSW 3 126438388 missense possibly damaging 0.52
R5664:Arsj UTSW 3 126438657 missense probably damaging 1.00
X0022:Arsj UTSW 3 126364966 missense possibly damaging 0.52
Z1088:Arsj UTSW 3 126439132 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGTGAAGAGGACATCTGCTCC -3'
(R):5'- TGAGCTTTTAGGGACCCCTC -3'

Sequencing Primer
(F):5'- GAAGAGGACATCTGCTCCCTTCTAG -3'
(R):5'- AGGGACCCCTCCTCTTCTAAG -3'
Posted On2017-10-10