Incidental Mutation 'R6928:Arhgap28'
List |< first << previous [record 42 of 585] next >> last >|
ID539874
Institutional Source Beutler Lab
Gene Symbol Arhgap28
Ensembl Gene ENSMUSG00000024043
Gene NameRho GTPase activating protein 28
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R6928 (G1)
Quality Score108.467
Status Not validated
Chromosome17
Chromosomal Location67842713-68004120 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) TCAGCAGCAGCAGCAGCAGCAG to TCAGCAGCAGCAGCAGCAG at 67901299 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024840] [ENSMUST00000163865] [ENSMUST00000164647]
Predicted Effect probably benign
Transcript: ENSMUST00000024840
SMART Domains Protein: ENSMUSP00000024840
Gene: ENSMUSG00000024043

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
RhoGAP 400 578 1.41e-34 SMART
Blast:RhoGAP 583 612 2e-7 BLAST
Blast:RhoGAP 640 681 9e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163865
SMART Domains Protein: ENSMUSP00000130960
Gene: ENSMUSG00000024043

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
RhoGAP 350 527 7.1e-31 SMART
Blast:RhoGAP 532 561 1e-7 BLAST
Blast:RhoGAP 589 630 8e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000164647
SMART Domains Protein: ENSMUSP00000128194
Gene: ENSMUSG00000024043

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
RhoGAP 350 528 1.41e-34 SMART
Blast:RhoGAP 533 562 1e-7 BLAST
Blast:RhoGAP 590 631 8e-6 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal bone length and ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcyap1r1 A G 6: 55,479,272 D215G possibly damaging Het
Asb3 A T 11: 30,998,326 M40L probably damaging Het
Aspg G A 12: 112,126,689 V547M possibly damaging Het
Aspm T A 1: 139,480,206 L2277* probably null Het
Atp7b A G 8: 21,994,812 S1295P probably benign Het
Cdca2 A G 14: 67,705,744 S199P probably damaging Het
Cdh1 A G 8: 106,661,010 E514G possibly damaging Het
Cenpk G T 13: 104,228,992 probably benign Het
Col6a5 C A 9: 105,939,919 V398L unknown Het
Colec10 A T 15: 54,462,606 K277N probably damaging Het
Cryzl2 T G 1: 157,470,787 S249A probably benign Het
Cspg4 T A 9: 56,897,880 Y1992N possibly damaging Het
Drd3 G T 16: 43,821,320 R333L probably benign Het
Espl1 C T 15: 102,298,907 R269C probably benign Het
Esr2 C T 12: 76,165,478 C188Y probably damaging Het
Focad A G 4: 88,348,875 D1041G unknown Het
Frem3 T C 8: 80,611,282 F68S possibly damaging Het
Gapdh A G 6: 125,162,671 V212A probably damaging Het
Gm10471 A G 5: 26,085,588 probably null Het
Gm10801 A AGT 2: 98,663,803 probably benign Het
Gm4778 T A 3: 94,266,548 C288S probably benign Het
Gm4858 G A 3: 93,073,960 C95Y probably damaging Het
Gzmb T C 14: 56,260,277 K169E probably benign Het
Hexdc T A 11: 121,212,054 F33I possibly damaging Het
Hsd3b6 T C 3: 98,810,953 I32V probably benign Het
Jcad T C 18: 4,673,372 V378A probably benign Het
Kcnmb2 T C 3: 32,199,041 S177P probably benign Het
Lrriq1 A T 10: 103,214,939 S651T possibly damaging Het
Map3k2 T C 18: 32,207,540 probably null Het
Mib1 T G 18: 10,802,282 S870A probably benign Het
Moap1 T A 12: 102,742,612 N226I probably damaging Het
Moxd1 T A 10: 24,300,288 N547K probably damaging Het
Mtmr9 A G 14: 63,543,593 V16A probably benign Het
Nme1 T C 11: 93,959,403 Y151C probably damaging Het
Nwd1 T C 8: 72,682,025 F879L probably benign Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr1451 A G 19: 12,999,838 N284S probably damaging Het
Olfr1454 A T 19: 13,063,984 H191L probably benign Het
Olfr209 C A 16: 59,361,463 G252C probably damaging Het
Olfr655 A T 7: 104,596,589 Y197* probably null Het
Olfr930 T C 9: 38,930,566 Y132H probably damaging Het
Olfr935 T C 9: 38,994,632 M268V probably benign Het
Pcdhb21 A G 18: 37,514,421 E201G probably damaging Het
Plscr1 T C 9: 92,269,951 V301A possibly damaging Het
Psg28 A T 7: 18,423,078 S411T possibly damaging Het
Rif1 T C 2: 52,095,961 W653R probably damaging Het
Rnd3 T A 2: 51,132,506 I175L probably benign Het
Rtn4 A G 11: 29,706,791 E199G possibly damaging Het
Sgpp1 T C 12: 75,716,570 Y279C probably damaging Het
Slc2a13 A G 15: 91,276,179 I524T probably damaging Het
Spg11 C T 2: 122,069,904 V1556I probably benign Het
Srebf2 C T 15: 82,203,723 R215* probably null Het
Tmem19 T C 10: 115,347,274 N147S possibly damaging Het
Tpr T C 1: 150,408,785 S408P possibly damaging Het
Trav13d-4 C T 14: 53,073,161 T53I probably damaging Het
Trf T A 9: 103,222,108 R168W possibly damaging Het
Trim11 A G 11: 58,988,843 K273R probably damaging Het
Tsacc T A 3: 88,282,940 M68L probably benign Het
Ttn T A 2: 76,754,525 M22110L probably benign Het
Zfp160 G T 17: 21,041,462 G104V probably benign Het
Zranb1 G A 7: 132,966,594 R301H possibly damaging Het
Other mutations in Arhgap28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Arhgap28 APN 17 67845801 missense probably damaging 1.00
IGL01388:Arhgap28 APN 17 67853039 unclassified probably benign
IGL01560:Arhgap28 APN 17 67896071 missense probably damaging 1.00
IGL01578:Arhgap28 APN 17 67858200 missense probably benign 0.00
IGL01650:Arhgap28 APN 17 67873132 missense probably damaging 0.97
IGL02383:Arhgap28 APN 17 67896089 missense probably benign 0.00
IGL02403:Arhgap28 APN 17 67873159 missense possibly damaging 0.87
IGL02652:Arhgap28 APN 17 67884800 missense probably benign 0.00
IGL03102:Arhgap28 APN 17 67896236 missense probably damaging 1.00
IGL03209:Arhgap28 APN 17 67868956 missense probably damaging 1.00
IGL03306:Arhgap28 APN 17 67852935 missense probably damaging 1.00
K3955:Arhgap28 UTSW 17 68004006 missense probably damaging 0.98
R0135:Arhgap28 UTSW 17 67864588 missense probably damaging 1.00
R0309:Arhgap28 UTSW 17 67901429 missense probably benign 0.13
R0385:Arhgap28 UTSW 17 67864606 missense probably damaging 1.00
R0412:Arhgap28 UTSW 17 67896258 missense probably damaging 1.00
R0463:Arhgap28 UTSW 17 67896225 missense probably damaging 1.00
R0626:Arhgap28 UTSW 17 67896113 unclassified probably null
R0691:Arhgap28 UTSW 17 67896164 unclassified probably null
R0811:Arhgap28 UTSW 17 67901299 small deletion probably benign
R1150:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1151:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1152:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1426:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1427:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1632:Arhgap28 UTSW 17 67849074 missense probably damaging 0.99
R1747:Arhgap28 UTSW 17 67901309 missense probably benign 0.02
R1951:Arhgap28 UTSW 17 67901341 missense probably benign 0.00
R2031:Arhgap28 UTSW 17 67896116 missense probably damaging 1.00
R2126:Arhgap28 UTSW 17 67869015 missense possibly damaging 0.90
R2181:Arhgap28 UTSW 17 67896117 missense probably damaging 1.00
R3700:Arhgap28 UTSW 17 67901366 missense probably damaging 1.00
R3800:Arhgap28 UTSW 17 67873036 missense probably damaging 1.00
R3811:Arhgap28 UTSW 17 67896093 missense probably benign
R4213:Arhgap28 UTSW 17 67871993 missense probably benign 0.04
R4347:Arhgap28 UTSW 17 67873142 missense probably benign
R4954:Arhgap28 UTSW 17 67869013 nonsense probably null
R5592:Arhgap28 UTSW 17 67858272 missense probably damaging 0.99
R5610:Arhgap28 UTSW 17 67896240 nonsense probably null
R5758:Arhgap28 UTSW 17 67873159 missense probably benign 0.04
R5774:Arhgap28 UTSW 17 67881492 missense possibly damaging 0.94
R6413:Arhgap28 UTSW 17 67875588 missense probably benign 0.00
R6661:Arhgap28 UTSW 17 67845751 missense probably damaging 1.00
Z1088:Arhgap28 UTSW 17 67861277 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AGGCCCAGTCTGTTTGAAG -3'
(R):5'- ACGAATCAACAGGATGCTCTCC -3'

Sequencing Primer
(F):5'- GCCCAGTCTGTTTGAAGAAAAAG -3'
(R):5'- GGATGCTCTCCAATGAATCCCTG -3'
Posted On2018-11-06