Incidental Mutation 'R5453:4921507P07Rik'
List |< first << previous [record 52 of 9592] next >> last >|
ID432623
Institutional Source Beutler Lab
Gene Symbol 4921507P07Rik
Ensembl Gene ENSMUSG00000029828
Gene NameRIKEN cDNA 4921507P07 gene
Synonyms
MMRRC Submission 043017-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R5453 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location50573302-50596632 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 50595796 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031852]
Predicted Effect probably null
Transcript: ENSMUST00000031852
SMART Domains Protein: ENSMUSP00000031852
Gene: ENSMUSG00000029828

DomainStartEndE-ValueType
Pfam:DUF4555 1 283 2e-149 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203814
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G A 11: 110,319,796 Q186* probably null Het
Adamts20 T C 15: 94,326,088 E1253G possibly damaging Het
Adgrd1 T C 5: 129,179,583 F640S probably damaging Het
Anxa1 C T 19: 20,380,339 probably null Het
Babam2 A G 5: 32,007,246 E288G probably damaging Het
Cd163 C T 6: 124,312,541 A406V probably damaging Het
Cdh13 A T 8: 119,198,967 D358V probably damaging Het
Cdk10 A G 8: 123,226,392 I45V probably benign Het
Crybg2 A T 4: 134,078,836 probably null Het
Dnhd1 A G 7: 105,710,123 D3555G probably damaging Het
Dync1h1 A G 12: 110,632,665 D1818G probably benign Het
Emsy T C 7: 98,600,806 K758R probably damaging Het
Fam126a A G 5: 23,987,879 probably null Het
Fat3 A G 9: 15,996,864 V2614A probably damaging Het
Hivep2 T C 10: 14,128,228 I190T possibly damaging Het
Hoxb3 T C 11: 96,344,654 S136P probably damaging Het
Hras A C 7: 141,192,855 V29G probably damaging Het
Igll1 A G 16: 16,863,694 probably null Het
Insr G A 8: 3,155,694 T1365I probably benign Het
Kitl T A 10: 100,087,385 W187R probably damaging Het
Klb T A 5: 65,383,385 F940L probably benign Het
Lrp1b C T 2: 41,282,237 R725K probably damaging Het
Map4 C T 9: 110,037,783 probably benign Het
Mrps35 A G 6: 147,070,617 S253G probably benign Het
Mycbp2 C T 14: 103,201,401 E2015K probably damaging Het
Nyap2 A C 1: 81,192,142 I205L probably benign Het
Olfr103 T C 17: 37,337,062 M57V possibly damaging Het
Olfr427 A G 1: 174,099,467 K3R probably benign Het
Rab11fip3 C T 17: 25,992,581 probably null Het
Rbm47 A G 5: 66,027,182 V26A probably benign Het
Ripk2 A T 4: 16,151,989 I190N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttc17 A T 2: 94,303,560 N1150K probably damaging Het
Zfp108 G T 7: 24,261,264 G427W probably damaging Het
Zfp84 A G 7: 29,776,297 E138G possibly damaging Het
Other mutations in 4921507P07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00852:4921507P07Rik APN 6 50589184 critical splice acceptor site probably null
IGL01310:4921507P07Rik APN 6 50574195 missense probably benign
IGL01568:4921507P07Rik APN 6 50573698 utr 3 prime probably benign
IGL01794:4921507P07Rik APN 6 50577846 missense probably damaging 1.00
IGL02718:4921507P07Rik APN 6 50584387 missense probably damaging 1.00
IGL03146:4921507P07Rik APN 6 50573873 missense probably damaging 0.97
IGL03381:4921507P07Rik APN 6 50589136 missense probably damaging 1.00
R1173:4921507P07Rik UTSW 6 50589141 missense probably damaging 0.98
R1174:4921507P07Rik UTSW 6 50589141 missense probably damaging 0.98
R1175:4921507P07Rik UTSW 6 50589141 missense probably damaging 0.98
R1769:4921507P07Rik UTSW 6 50591821 splice site probably benign
R1883:4921507P07Rik UTSW 6 50574453 missense probably benign 0.01
R2056:4921507P07Rik UTSW 6 50573745 missense possibly damaging 0.71
R2437:4921507P07Rik UTSW 6 50583979 missense probably damaging 1.00
R2929:4921507P07Rik UTSW 6 50574305 missense probably benign 0.07
R4357:4921507P07Rik UTSW 6 50574210 missense probably benign
R4666:4921507P07Rik UTSW 6 50595828 missense possibly damaging 0.69
R4791:4921507P07Rik UTSW 6 50595837 missense probably damaging 1.00
R4827:4921507P07Rik UTSW 6 50595856 missense possibly damaging 0.76
R4976:4921507P07Rik UTSW 6 50589184 critical splice acceptor site probably null
R6689:4921507P07Rik UTSW 6 50589109 critical splice donor site probably null
R6897:4921507P07Rik UTSW 6 50589165 missense possibly damaging 0.82
X0021:4921507P07Rik UTSW 6 50573926 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGAAGAATATGCCTCCCTTG -3'
(R):5'- AACCAAGGCAGTTTACAAGTCC -3'

Sequencing Primer
(F):5'- GAAGAATATGCCTCCCTTGTTATAGC -3'
(R):5'- GGCAGTTTACAAGTCCAAATTTTC -3'
Posted On2016-10-06