Incidental Mutation 'R2181:1700037C18Rik'
List |< first << previous [record 74 of 33389] next >> last >|
ID237204
Institutional Source Beutler Lab
Gene Symbol 1700037C18Rik
Ensembl Gene ENSMUSG00000005983
Gene NameRIKEN cDNA 1700037C18 gene
Synonyms
MMRRC Submission 040183-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R2181 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location3895179-3908689 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3907086 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 43 (S43N)
Ref Sequence ENSEMBL: ENSMUSP00000135233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006138] [ENSMUST00000006139] [ENSMUST00000040881] [ENSMUST00000115859] [ENSMUST00000115860] [ENSMUST00000123235] [ENSMUST00000124849] [ENSMUST00000139294] [ENSMUST00000143537] [ENSMUST00000145150] [ENSMUST00000150655] [ENSMUST00000176233] [ENSMUST00000177221] [ENSMUST00000177323] [ENSMUST00000186375]
Predicted Effect probably benign
Transcript: ENSMUST00000006138
SMART Domains Protein: ENSMUSP00000006138
Gene: ENSMUSG00000005982

DomainStartEndE-ValueType
Pfam:Acetyltransf_7 50 157 4.2e-11 PFAM
Pfam:Acetyltransf_1 57 156 4.2e-15 PFAM
Pfam:FR47 77 164 8.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000006139
AA Change: S52N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000006139
Gene: ENSMUSG00000005983
AA Change: S52N

DomainStartEndE-ValueType
Pfam:DUF4644 16 139 7.3e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040881
SMART Domains Protein: ENSMUSP00000043397
Gene: ENSMUSG00000014232

DomainStartEndE-ValueType
Pfam:Cluap1 14 283 2.5e-121 PFAM
low complexity region 297 307 N/A INTRINSIC
low complexity region 310 330 N/A INTRINSIC
low complexity region 360 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115859
AA Change: S38N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111525
Gene: ENSMUSG00000005983
AA Change: S38N

DomainStartEndE-ValueType
Pfam:DUF4644 2 162 4.7e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115860
SMART Domains Protein: ENSMUSP00000111526
Gene: ENSMUSG00000005982

DomainStartEndE-ValueType
Pfam:Acetyltransf_7 50 157 4.2e-11 PFAM
Pfam:Acetyltransf_1 57 156 4.2e-15 PFAM
Pfam:FR47 77 164 8.2e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000123235
AA Change: S43N

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135233
Gene: ENSMUSG00000005983
AA Change: S43N

DomainStartEndE-ValueType
Pfam:DUF4644 7 67 1.5e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124849
SMART Domains Protein: ENSMUSP00000119490
Gene: ENSMUSG00000014232

DomainStartEndE-ValueType
Pfam:Cluap1 3 206 8.7e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137745
Predicted Effect probably benign
Transcript: ENSMUST00000139294
Predicted Effect probably benign
Transcript: ENSMUST00000143537
SMART Domains Protein: ENSMUSP00000135188
Gene: ENSMUSG00000005982

DomainStartEndE-ValueType
SCOP:d1cjwa_ 10 113 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145150
SMART Domains Protein: ENSMUSP00000116855
Gene: ENSMUSG00000014232

DomainStartEndE-ValueType
Pfam:Cluap1 3 188 9.9e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146935
Predicted Effect probably benign
Transcript: ENSMUST00000150655
SMART Domains Protein: ENSMUSP00000135206
Gene: ENSMUSG00000005982

DomainStartEndE-ValueType
Pfam:Acetyltransf_7 50 157 4.2e-11 PFAM
Pfam:Acetyltransf_1 57 156 4.2e-15 PFAM
Pfam:FR47 77 164 8.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176233
SMART Domains Protein: ENSMUSP00000135826
Gene: ENSMUSG00000093575

DomainStartEndE-ValueType
Pfam:Cluap1 119 282 2.8e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177221
AA Change: S49N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000134800
Gene: ENSMUSG00000005983
AA Change: S49N

DomainStartEndE-ValueType
Pfam:DUF4644 13 144 7.2e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177323
AA Change: S42N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135766
Gene: ENSMUSG00000005983
AA Change: S42N

DomainStartEndE-ValueType
Pfam:DUF4644 6 166 1.5e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177519
Predicted Effect probably benign
Transcript: ENSMUST00000186375
SMART Domains Protein: ENSMUSP00000140031
Gene: ENSMUSG00000005982

DomainStartEndE-ValueType
Pfam:Acetyltransf_7 50 157 4.2e-11 PFAM
Pfam:Acetyltransf_1 57 156 4.2e-15 PFAM
Pfam:FR47 77 164 8.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195807
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T G 12: 118,867,946 I1224L possibly damaging Het
Adgra2 G A 8: 27,121,673 G1002S probably damaging Het
Arhgap28 T C 17: 67,896,117 T114A probably damaging Het
Colec12 T A 18: 9,846,828 S75T probably damaging Het
Cyp2c67 A G 19: 39,609,097 C486R possibly damaging Het
Ecm2 T A 13: 49,530,289 L581Q probably damaging Het
Faxc T A 4: 21,931,591 S10T probably benign Het
Frem2 A G 3: 53,574,587 I1893T possibly damaging Het
Gabrr3 T A 16: 59,448,009 D328E probably damaging Het
Gbp7 A G 3: 142,544,030 I421V possibly damaging Het
Gorasp1 A G 9: 119,928,356 S317P probably damaging Het
Htr6 A G 4: 139,074,425 S113P probably damaging Het
Ift74 A G 4: 94,632,714 E168G probably damaging Het
Kdm6b A T 11: 69,401,126 Y1443* probably null Het
Mmp28 A C 11: 83,442,717 V466G possibly damaging Het
Nbea A T 3: 56,029,939 S750R possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nelfa T C 5: 33,900,509 N314D probably benign Het
Numbl T A 7: 27,268,921 probably null Het
Olfr1370 G T 13: 21,073,224 P26T probably damaging Het
Olfr1467 G T 19: 13,365,074 V149F probably benign Het
Olfr272 T A 4: 52,911,524 K90M probably damaging Het
Olfr346 G A 2: 36,688,334 D111N probably damaging Het
Olfr678 T C 7: 105,070,211 V248A possibly damaging Het
Penk T C 4: 4,134,041 probably null Het
Pglyrp2 A G 17: 32,418,962 S31P probably damaging Het
Pigg T C 5: 108,336,500 S538P probably damaging Het
Pld2 A G 11: 70,542,989 T252A possibly damaging Het
Ppp2r5e T C 12: 75,462,324 I394V probably benign Het
Sh3rf1 G T 8: 61,363,238 V510F probably damaging Het
Slc4a2 A G 5: 24,435,653 H677R possibly damaging Het
Stam2 A T 2: 52,703,144 H345Q probably benign Het
Tmtc3 T C 10: 100,448,973 N600S probably benign Het
Trappc8 A G 18: 20,819,222 probably null Het
Vmn1r72 A T 7: 11,669,668 C284* probably null Het
Vmn2r76 T C 7: 86,225,535 I745V probably benign Het
Zfhx4 A C 3: 5,403,332 D2850A probably damaging Het
Zfp764 A G 7: 127,406,499 W36R probably damaging Het
Zfp804b G A 5: 6,771,674 T463I probably damaging Het
Zfp811 T G 17: 32,797,721 K448N probably damaging Het
Other mutations in 1700037C18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02275:1700037C18Rik APN 16 3906282 missense probably damaging 1.00
R0485:1700037C18Rik UTSW 16 3907647 missense probably damaging 0.99
R1579:1700037C18Rik UTSW 16 3906175 missense probably benign 0.39
R1643:1700037C18Rik UTSW 16 3907078 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATGGCTGTTACCTGGACCC -3'
(R):5'- CAGGAACTAAGACTGGATAGCC -3'

Sequencing Primer
(F):5'- AGTGGCTTCCACATTGG -3'
(R):5'- TAGAAGCTACGTATGAGTTGGTAC -3'
Posted On2014-10-02