Incidental Mutation 'R0060:Ankrd60'
List |< first << previous [record 77 of 1308] next >> last >|
ID64390
Institutional Source Beutler Lab
Gene Symbol Ankrd60
Ensembl Gene ENSMUSG00000027517
Gene Nameankyrin repeat domain 60
Synonyms1700019A24Rik, 1700030G11Rik
MMRRC Submission 038353-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0060 (G1)
Quality Score90
Status Validated
Chromosome2
Chromosomal Location173568666-173578365 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 173572613 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000104740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109112] [ENSMUST00000119453]
Predicted Effect probably null
Transcript: ENSMUST00000109112
AA Change: M1K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104740
Gene: ENSMUSG00000027517
AA Change: M1K

DomainStartEndE-ValueType
ANK 73 102 2.83e0 SMART
ANK 106 135 2.13e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119453
AA Change: M121K

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113291
Gene: ENSMUSG00000027517
AA Change: M121K

DomainStartEndE-ValueType
low complexity region 1 21 N/A INTRINSIC
Blast:UBQ 70 142 5e-39 BLAST
ANK 193 222 2.83e0 SMART
ANK 226 255 2.13e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147693
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A C 11: 58,422,182 probably benign Het
A630091E08Rik A G 7: 98,543,668 noncoding transcript Het
Abca8a T C 11: 110,070,480 T539A probably damaging Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Cabcoco1 A T 10: 68,533,862 probably null Het
Capn7 T C 14: 31,365,604 probably benign Het
Cd109 G A 9: 78,703,107 E1145K probably damaging Het
Celsr1 A T 15: 85,922,198 V2353D probably damaging Het
Cep350 C T 1: 155,928,626 D904N probably damaging Het
Chl1 T A 6: 103,711,058 probably benign Het
Colec10 G A 15: 54,439,146 probably benign Het
Cst11 T A 2: 148,770,402 Q105L probably damaging Het
Eps8l3 T C 3: 107,879,541 L11S probably damaging Het
Gsdme A G 6: 50,221,029 I317T possibly damaging Het
Itgad T C 7: 128,202,986 S979P probably damaging Het
Mga T C 2: 119,960,961 probably null Het
Nubpl T C 12: 52,310,687 probably benign Het
Olfr1105 T C 2: 87,033,774 Y149C probably damaging Het
Olfr124 T C 17: 37,806,000 L285P probably damaging Het
Pard3b G A 1: 61,639,315 E25K probably damaging Het
Phactr1 T A 13: 42,682,721 Y8* probably null Het
Phf14 T C 6: 11,953,317 S352P probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prap1 G T 7: 140,093,477 probably benign Het
Prdm8 T A 5: 98,185,260 F229I probably benign Het
Rfx6 T C 10: 51,677,840 F11L probably benign Het
Rfx8 T A 1: 39,718,405 probably benign Het
Rif1 C T 2: 52,111,117 R1528C probably damaging Het
Ripk4 G A 16: 97,763,518 probably benign Het
Satb1 T A 17: 51,740,203 I695F probably damaging Het
Sema4d A G 13: 51,705,257 probably benign Het
Slc30a4 T A 2: 122,685,184 T381S probably benign Het
Suv39h2 T C 2: 3,464,916 Y134C probably damaging Het
Tcerg1 C T 18: 42,524,008 A185V unknown Het
Tep1 T A 14: 50,866,029 D268V probably damaging Het
Tmem89 T A 9: 108,915,417 V126D probably damaging Het
Trf T C 9: 103,220,922 T46A probably benign Het
Trmt6 C T 2: 132,806,769 R415Q possibly damaging Het
Trp53bp1 T C 2: 121,204,525 K1625E probably damaging Het
Zcchc4 T A 5: 52,807,078 I292N possibly damaging Het
Other mutations in Ankrd60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01980:Ankrd60 APN 2 173571203 missense probably benign 0.33
R0060:Ankrd60 UTSW 2 173572613 start codon destroyed probably null 1.00
R0569:Ankrd60 UTSW 2 173571066 missense probably damaging 1.00
R0587:Ankrd60 UTSW 2 173568851 missense possibly damaging 0.83
R2941:Ankrd60 UTSW 2 173568881 missense probably damaging 1.00
R4549:Ankrd60 UTSW 2 173572602 missense possibly damaging 0.89
R5322:Ankrd60 UTSW 2 173568817 missense possibly damaging 0.76
R5763:Ankrd60 UTSW 2 173578089 frame shift probably null
R5786:Ankrd60 UTSW 2 173578089 frame shift probably null
R5787:Ankrd60 UTSW 2 173578089 frame shift probably null
R5788:Ankrd60 UTSW 2 173578089 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACACTCTCCATGCAGAAAGCTCTTC -3'
(R):5'- AATTTCAGGCTCCTGTGCGACC -3'

Sequencing Primer
(F):5'- TTCACACTAAAGACTAAAGACTGGG -3'
(R):5'- TCCTGTGCGACCATCAAG -3'
Posted On2013-08-06