Incidental Mutation 'R6373:Aldh16a1'
List |< first << previous [record 87 of 1871] next >> last >|
ID513627
Institutional Source Beutler Lab
Gene Symbol Aldh16a1
Ensembl Gene ENSMUSG00000007833
Gene Namealdehyde dehydrogenase 16 family, member A1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6373 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45140684-45154584 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 45146271 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 373 (V373L)
Ref Sequence ENSEMBL: ENSMUSP00000148069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107815] [ENSMUST00000209957] [ENSMUST00000209963] [ENSMUST00000210125] [ENSMUST00000211169] [ENSMUST00000211362]
Predicted Effect probably benign
Transcript: ENSMUST00000107815
AA Change: V373L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103445
Gene: ENSMUSG00000007833
AA Change: V373L

DomainStartEndE-ValueType
Pfam:Aldedh 48 488 3.8e-87 PFAM
Pfam:Aldedh 536 753 2.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209889
Predicted Effect probably benign
Transcript: ENSMUST00000209957
Predicted Effect probably benign
Transcript: ENSMUST00000209963
AA Change: V373L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000210125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210725
Predicted Effect probably benign
Transcript: ENSMUST00000211169
Predicted Effect probably benign
Transcript: ENSMUST00000211362
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 95% (37/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldehyde dehydrogenase superfamily. The family members act on aldehyde substrates and use nicotinamide adenine dinucleotide phosphate (NADP) as a cofactor. This gene is conserved in chimpanzee, dog, cow, mouse, rat, and zebrafish. The protein encoded by this gene interacts with maspardin, a protein that when truncated is responsible for Mast syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T C 8: 9,988,240 L279P probably damaging Het
Btn2a2 T C 13: 23,481,829 K278E probably benign Het
Carns1 G T 19: 4,166,516 Q556K probably benign Het
Chd1 A T 17: 15,738,636 E650V probably damaging Het
Cobl A G 11: 12,253,118 S1195P probably damaging Het
Ddx58 A G 4: 40,216,487 Y504H possibly damaging Het
Deup1 T C 9: 15,561,342 H464R probably damaging Het
Eva1a T C 6: 82,091,866 L58S probably damaging Het
Fign A C 2: 63,979,645 M427R probably benign Het
Gm6309 A T 5: 146,170,275 I87N probably damaging Het
Gm7879 A G 5: 43,913,551 T127A probably damaging Het
Helz A G 11: 107,595,184 T140A probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hist1h2ad A G 13: 23,574,853 K128R probably benign Het
Kif16b A T 2: 142,699,698 H1227Q possibly damaging Het
Mab21l1 A T 3: 55,783,084 I31F possibly damaging Het
Mex3c T C 18: 73,589,994 M386T probably benign Het
Myh11 T A 16: 14,205,130 I1644F possibly damaging Het
Nav2 C T 7: 49,453,175 P513S probably damaging Het
Ncoa3 C T 2: 166,059,347 S953F possibly damaging Het
Nmt2 A G 2: 3,324,951 T462A probably benign Het
Nrxn2 T C 19: 6,509,830 I163T probably damaging Het
Nrxn3 G C 12: 89,976,469 G122R probably damaging Het
Olfr1165-ps T C 2: 88,101,845 I47M possibly damaging Het
Olfr385 A G 11: 73,588,898 V280A probably benign Het
Parg T G 14: 32,209,497 probably null Het
Pcdhb7 T A 18: 37,342,211 C133* probably null Het
Rpe T C 1: 66,715,980 F174L probably benign Het
Rxrb A G 17: 34,033,559 N40S probably benign Het
Ryr3 C A 2: 112,656,544 G3840W probably damaging Het
Smurf2 A G 11: 106,833,769 L529P probably damaging Het
Sntg2 C T 12: 30,258,041 R215H probably benign Het
Spata20 A G 11: 94,483,400 V348A probably benign Het
Spink5 A G 18: 43,990,672 E342G probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syce1l T A 8: 113,649,511 M31K probably benign Het
Ttn C T 2: 76,788,616 V14394I probably damaging Het
Twnk G A 19: 45,009,381 V450M probably damaging Het
Vangl1 T C 3: 102,158,448 K407R probably benign Het
Vmn1r19 T C 6: 57,405,332 I290T unknown Het
Other mutations in Aldh16a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Aldh16a1 APN 7 45145513 missense probably benign 0.00
IGL01449:Aldh16a1 APN 7 45141967 missense probably damaging 0.99
IGL01599:Aldh16a1 APN 7 45142093 missense probably damaging 0.99
IGL02118:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02120:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02123:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02125:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02126:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02794:Aldh16a1 APN 7 45145594 missense probably damaging 0.98
IGL03348:Aldh16a1 APN 7 45141975 missense possibly damaging 0.85
R0242:Aldh16a1 UTSW 7 45144664 missense probably damaging 1.00
R0242:Aldh16a1 UTSW 7 45144664 missense probably damaging 1.00
R0305:Aldh16a1 UTSW 7 45147979 missense probably damaging 1.00
R0532:Aldh16a1 UTSW 7 45142838 missense probably damaging 1.00
R0550:Aldh16a1 UTSW 7 45146229 unclassified probably null
R0707:Aldh16a1 UTSW 7 45144507 unclassified probably benign
R0801:Aldh16a1 UTSW 7 45147476 missense probably benign 0.00
R1224:Aldh16a1 UTSW 7 45142047 unclassified probably null
R1371:Aldh16a1 UTSW 7 45147250 missense possibly damaging 0.78
R1778:Aldh16a1 UTSW 7 45147308 missense probably damaging 1.00
R2064:Aldh16a1 UTSW 7 45147161 critical splice donor site probably null
R4616:Aldh16a1 UTSW 7 45148788 intron probably benign
R4859:Aldh16a1 UTSW 7 45147307 missense probably benign 0.10
R4928:Aldh16a1 UTSW 7 45141961 missense probably damaging 1.00
R5476:Aldh16a1 UTSW 7 45142069 missense possibly damaging 0.89
R5591:Aldh16a1 UTSW 7 45144652 missense probably null 0.82
R5647:Aldh16a1 UTSW 7 45154465 missense probably benign 0.00
R5692:Aldh16a1 UTSW 7 45147799 missense probably damaging 1.00
R5698:Aldh16a1 UTSW 7 45154407 unclassified probably benign
R5879:Aldh16a1 UTSW 7 45147506 nonsense probably null
R5890:Aldh16a1 UTSW 7 45144545 missense probably benign 0.00
R6321:Aldh16a1 UTSW 7 45149765 missense probably damaging 1.00
R6338:Aldh16a1 UTSW 7 45141961 missense probably damaging 1.00
R6497:Aldh16a1 UTSW 7 45144937 missense possibly damaging 0.93
R6566:Aldh16a1 UTSW 7 45143227 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GCGTTAGTCGGAGAGCAAAC -3'
(R):5'- CTGGACTTAAGTGTCTAAGGGAGG -3'

Sequencing Primer
(F):5'- AGCAAACTCTCCTGTCAATACTTTAC -3'
(R):5'- TGTCTAAGGGAGGAGGGCTC -3'
Posted On2018-04-27