Incidental Mutation 'R0948:1810009A15Rik'
List |< first << previous [record 89 of 33389] next >> last >|
ID81737
Institutional Source Beutler Lab
Gene Symbol 1810009A15Rik
Ensembl Gene ENSMUSG00000071653
Gene NameRIKEN cDNA 1810009A15 gene
Synonyms
MMRRC Submission 039087-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R0948 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8888853-8890881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 8890026 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 63 (T63M)
Ref Sequence ENSEMBL: ENSMUSP00000140564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096249] [ENSMUST00000096251] [ENSMUST00000177826] [ENSMUST00000185488] [ENSMUST00000187504] [ENSMUST00000191089]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093658
Predicted Effect probably benign
Transcript: ENSMUST00000096249
SMART Domains Protein: ENSMUSP00000093968
Gene: ENSMUSG00000071652

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:INTS5_N 29 252 1e-82 PFAM
low complexity region 254 267 N/A INTRINSIC
Pfam:INTS5_C 289 998 2.2e-249 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000096251
AA Change: T63M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093970
Gene: ENSMUSG00000071653
AA Change: T63M

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175573
Predicted Effect probably benign
Transcript: ENSMUST00000177826
SMART Domains Protein: ENSMUSP00000137432
Gene: ENSMUSG00000116166

DomainStartEndE-ValueType
Pfam:Lbh 1 101 1.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185488
SMART Domains Protein: ENSMUSP00000140221
Gene: ENSMUSG00000071653

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187037
Predicted Effect silent
Transcript: ENSMUST00000187504
SMART Domains Protein: ENSMUSP00000139692
Gene: ENSMUSG00000096740

DomainStartEndE-ValueType
Pfam:Lbh 1 101 2.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190843
Predicted Effect probably damaging
Transcript: ENSMUST00000191089
AA Change: T63M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140564
Gene: ENSMUSG00000116347
AA Change: T63M

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.4%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,740,621 probably null Het
Ahrr T C 13: 74,213,769 D537G probably damaging Het
Anxa4 T A 6: 86,741,931 I269F probably damaging Het
Atm A T 9: 53,495,958 M1160K probably benign Het
Ccdc175 A G 12: 72,131,123 Y434H probably damaging Het
Col19a1 C T 1: 24,296,801 A855T probably damaging Het
Cyp2a4 A G 7: 26,310,788 D246G probably damaging Het
Dmbt1 T C 7: 131,093,117 L840P possibly damaging Het
Dock6 A T 9: 21,801,533 D2009E probably damaging Het
Doxl2 A G 6: 48,976,344 Y401C probably damaging Het
E2f3 C T 13: 29,985,533 A46T probably damaging Het
Ect2l A T 10: 18,140,586 C635S probably damaging Het
Fam129b A G 2: 32,922,860 Y480C probably damaging Het
Fer1l6 A G 15: 58,564,075 D439G probably benign Het
Gm5434 A T 12: 36,090,935 probably benign Het
Hao1 A C 2: 134,530,773 M105R probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Igsf10 A G 3: 59,331,104 I552T probably damaging Het
Il31ra A G 13: 112,530,378 S470P possibly damaging Het
Mfsd1 A G 3: 67,596,734 N353S possibly damaging Het
Mga T A 2: 119,941,659 F1667I possibly damaging Het
Nwd2 T C 5: 63,807,312 V1413A probably damaging Het
Olfr906 T G 9: 38,488,948 S306R probably benign Het
Olfr914 G A 9: 38,606,491 V9I possibly damaging Het
Osbpl10 T A 9: 115,167,119 V119E probably damaging Het
Plec C A 15: 76,205,687 R151L probably benign Het
Ptpn12 T C 5: 20,998,043 H579R probably benign Het
Rnase4 G T 14: 51,104,905 G29C probably damaging Het
Sim1 C A 10: 50,981,327 S391* probably null Het
Sobp A T 10: 43,022,209 I460N probably damaging Het
Spns3 A T 11: 72,545,940 D75E probably damaging Het
Strn4 T A 7: 16,837,713 C26* probably null Het
Tacstd2 T A 6: 67,535,118 I197L probably damaging Het
Trpc6 A G 9: 8,610,415 T295A possibly damaging Het
Txnl1 G T 18: 63,692,120 S18R possibly damaging Het
U2surp A G 9: 95,461,497 probably benign Het
Vwce A G 19: 10,653,077 Y500C probably damaging Het
Wdr49 A C 3: 75,450,851 S196A probably benign Het
Wfs1 T C 5: 36,967,561 Y662C probably damaging Het
Wnt8b A C 19: 44,510,529 D133A possibly damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp532 C A 18: 65,623,818 A274E probably damaging Het
Zfp74 A G 7: 29,935,937 probably null Het
Other mutations in 1810009A15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0960:1810009A15Rik UTSW 19 8890428 missense probably benign
R1412:1810009A15Rik UTSW 19 8889995 splice site probably benign
R2887:1810009A15Rik UTSW 19 8890031 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACACCAGAGCCCATTCAGTAATTTG -3'
(R):5'- TCAAGATCCTCCATAGCTACGTCCTG -3'

Sequencing Primer
(F):5'- actgggcaatgatgctcc -3'
(R):5'- ctcacaaccatccataacaaaaatc -3'
Posted On2013-11-08