Mutagenetix > Incidental Mutations

Incidental Mutation 'R0749:Btn2a2'

List |< first << previous [record 958 of 958]

70261

Institutional Source

Beutler Lab

Gene Symbol

Btn2a2

Ensembl Gene

ENSMUSG00000053216

Gene Name

butyrophilin, subfamily 2, member A2

Synonyms

MMRRC Submission

038929-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.137) question?

Stock #

R0749 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23477676-23488857 bp(-) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

T to C at 23478398 bp

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Tryptophan at position 418 (*418W)

Ref Sequence

ENSEMBL: ENSMUSP00000048251 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041541] [ENSMUST00000110432] [ENSMUST00000110433] [ENSMUST00000223877]

Predicted Effect

probably null
Transcript: ENSMUST00000041541
AA Change: *418W

SMART Domains

Protein: ENSMUSP00000048251
Gene: ENSMUSG00000053216
AA Change: *418W

Domain	Start	End	E-Value	Type
low complexity region	14	28	N/A	INTRINSIC
IG	37	144	9.12e-7	SMART
Pfam:C2-set_2	148	231	3.3e-8	PFAM
transmembrane domain	250	272	N/A	INTRINSIC
coiled coil region	276	304	N/A	INTRINSIC
PRY	312	364	1.87e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110432
AA Change: T461A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000106062
Gene: ENSMUSG00000053216
AA Change: T461A

Domain	Start	End	E-Value	Type
low complexity region	14	28	N/A	INTRINSIC
IG	37	144	9.12e-7	SMART
Blast:IG_like	151	211	1e-29	BLAST
transmembrane domain	250	272	N/A	INTRINSIC
coiled coil region	276	304	N/A	INTRINSIC
PRY	312	364	1.87e-27	SMART
SPRY	365	485	3.56e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110433
AA Change: T461A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000106063
Gene: ENSMUSG00000053216
AA Change: T461A

Domain	Start	End	E-Value	Type
low complexity region	14	28	N/A	INTRINSIC
IG	37	144	9.12e-7	SMART
Pfam:C2-set_2	148	231	1.2e-8	PFAM
transmembrane domain	250	272	N/A	INTRINSIC
coiled coil region	276	304	N/A	INTRINSIC
PRY	312	364	1.87e-27	SMART
SPRY	365	485	3.56e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000223877
AA Change: T452A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Butyrophilin is the major protein associated with fat droplets in the milk. This gene is a member of the BTN2 subfamily of genes, which encode proteins belonging to the butyrophilin protein family. The gene is located in a cluster on chromosome 6, consisting of seven genes belonging to the expanding B7/butyrophilin-like group, a subset of the immunoglobulin gene superfamily. The encoded protein is a type I receptor glycoprotein involved in lipid, fatty-acid and sterol metabolism. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]

Allele List at MGI

Other mutations in this stock

Total: 27 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aprt	A	T	8: 122,575,410	Y105N	probably damaging	Het
Atxn2l	A	T	7: 126,500,837	S109T	possibly damaging	Het
Bbs9	T	C	9: 22,575,201		probably null	Het
Bmp4	T	C	14: 46,384,613	E158G	probably damaging	Het
Cpt1c	A	G	7: 44,962,826	Y494H	probably damaging	Het
Cyp3a16	T	A	5: 145,456,177		probably null	Het
Dpy19l1	T	A	9: 24,462,584	H270L	probably benign	Het
Fdxr	A	G	11: 115,276,845	S15P	probably benign	Het
Gm8688	T	G	8: 99,664,520		noncoding transcript	Het
Golph3l	G	A	3: 95,607,949	R134Q	probably damaging	Het
Hmgxb4	A	G	8: 75,000,937	T183A	probably damaging	Het
Krt2	T	G	15: 101,817,663	S147R	unknown	Het
Lipn	T	C	19: 34,076,979	S206P	probably damaging	Het
Mcpt2	A	G	14: 56,043,679		probably null	Het
Metap2	T	C	10: 93,879,567	E133G	probably benign	Het
Nuak1	T	C	10: 84,374,784	Y480C	probably damaging	Het
Oma1	C	T	4: 103,325,299	Q300*	probably null	Het
Pcnt	T	C	10: 76,381,364	E2161G	probably damaging	Het
Pkdrej	G	T	15: 85,818,074	D1220E	probably benign	Het
Ptdss1	T	A	13: 66,987,850	C390*	probably null	Het
Sars	A	C	3: 108,428,266	F389V	possibly damaging	Het
Sec31b	C	T	19: 44,524,506	V515M	probably damaging	Het
Syt3	A	G	7: 44,399,147	E587G	probably benign	Het
Tjp2	T	C	19: 24,122,272	E417G	possibly damaging	Het
Tmem63b	A	G	17: 45,666,115	F442S	possibly damaging	Het
Togaram1	A	G	12: 64,982,698	D965G	possibly damaging	Het
Zmynd10	T	C	9: 107,548,683	V72A	probably damaging	Het

Other mutations in Btn2a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Btn2a2	APN	13	23478576	missense	probably damaging	1.00
IGL00740:Btn2a2	APN	13	23478485	missense	probably benign
IGL02053:Btn2a2	APN	13	23478820	missense	probably damaging	1.00
IGL02720:Btn2a2	APN	13	23480467	missense	probably benign	0.15
IGL02738:Btn2a2	APN	13	23478806	nonsense	probably null
IGL03010:Btn2a2	APN	13	23486205	nonsense	probably null
IGL03221:Btn2a2	APN	13	23478449	missense	probably damaging	1.00
R0066:Btn2a2	UTSW	13	23478485	missense	probably benign	0.01
R0066:Btn2a2	UTSW	13	23478485	missense	probably benign	0.01
R0597:Btn2a2	UTSW	13	23486410	missense	probably benign	0.12
R1209:Btn2a2	UTSW	13	23480566	critical splice donor site	probably null
R1283:Btn2a2	UTSW	13	23478832	missense	probably damaging	0.98
R1718:Btn2a2	UTSW	13	23481936	missense	probably benign	0.01
R2925:Btn2a2	UTSW	13	23481814	missense	probably damaging	1.00
R3824:Btn2a2	UTSW	13	23480465	missense	probably benign	0.02
R5281:Btn2a2	UTSW	13	23478832	missense	probably damaging	0.98
R5356:Btn2a2	UTSW	13	23482875	missense	probably benign	0.02
R5482:Btn2a2	UTSW	13	23486387	missense	probably benign	0.03
R5535:Btn2a2	UTSW	13	23478275	missense	probably benign	0.14
R5629:Btn2a2	UTSW	13	23481960	splice site	probably null
R5930:Btn2a2	UTSW	13	23486228	missense	probably damaging	0.96
R5952:Btn2a2	UTSW	13	23482808	missense	probably benign	0.09
R6006:Btn2a2	UTSW	13	23486363	missense	probably damaging	1.00
R6196:Btn2a2	UTSW	13	23487845	missense	possibly damaging	0.74
R6373:Btn2a2	UTSW	13	23481829	missense	probably benign	0.00
R6533:Btn2a2	UTSW	13	23481781	nonsense	probably null
R6891:Btn2a2	UTSW	13	23482844	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- AGCAATAGTCCCCTAAGACTGGCTC -3'
(R):5'- AATGGCTTCTGGACCCTGGAGATG -3'

Sequencing Primer
(F):5'- ATGCTCCATGTGATCTGAAGGAC -3'
(R):5'- ACCCTGGAGATGTTTGGAAGC -3'

Posted On

2013-09-30