Incidental Mutation 'R0749:Btn2a2'
List |< first << previous [record 958 of 958]
ID70261
Institutional Source Beutler Lab
Gene Symbol Btn2a2
Ensembl Gene ENSMUSG00000053216
Gene Namebutyrophilin, subfamily 2, member A2
Synonyms
MMRRC Submission 038929-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R0749 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23477676-23488857 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 23478398 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 418 (*418W)
Ref Sequence ENSEMBL: ENSMUSP00000048251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041541] [ENSMUST00000110432] [ENSMUST00000110433] [ENSMUST00000223877]
Predicted Effect probably null
Transcript: ENSMUST00000041541
AA Change: *418W
SMART Domains Protein: ENSMUSP00000048251
Gene: ENSMUSG00000053216
AA Change: *418W

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 37 144 9.12e-7 SMART
Pfam:C2-set_2 148 231 3.3e-8 PFAM
transmembrane domain 250 272 N/A INTRINSIC
coiled coil region 276 304 N/A INTRINSIC
PRY 312 364 1.87e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110432
AA Change: T461A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106062
Gene: ENSMUSG00000053216
AA Change: T461A

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 37 144 9.12e-7 SMART
Blast:IG_like 151 211 1e-29 BLAST
transmembrane domain 250 272 N/A INTRINSIC
coiled coil region 276 304 N/A INTRINSIC
PRY 312 364 1.87e-27 SMART
SPRY 365 485 3.56e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110433
AA Change: T461A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106063
Gene: ENSMUSG00000053216
AA Change: T461A

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 37 144 9.12e-7 SMART
Pfam:C2-set_2 148 231 1.2e-8 PFAM
transmembrane domain 250 272 N/A INTRINSIC
coiled coil region 276 304 N/A INTRINSIC
PRY 312 364 1.87e-27 SMART
SPRY 365 485 3.56e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223877
AA Change: T452A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Butyrophilin is the major protein associated with fat droplets in the milk. This gene is a member of the BTN2 subfamily of genes, which encode proteins belonging to the butyrophilin protein family. The gene is located in a cluster on chromosome 6, consisting of seven genes belonging to the expanding B7/butyrophilin-like group, a subset of the immunoglobulin gene superfamily. The encoded protein is a type I receptor glycoprotein involved in lipid, fatty-acid and sterol metabolism. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aprt A T 8: 122,575,410 Y105N probably damaging Het
Atxn2l A T 7: 126,500,837 S109T possibly damaging Het
Bbs9 T C 9: 22,575,201 probably null Het
Bmp4 T C 14: 46,384,613 E158G probably damaging Het
Cpt1c A G 7: 44,962,826 Y494H probably damaging Het
Cyp3a16 T A 5: 145,456,177 probably null Het
Dpy19l1 T A 9: 24,462,584 H270L probably benign Het
Fdxr A G 11: 115,276,845 S15P probably benign Het
Gm8688 T G 8: 99,664,520 noncoding transcript Het
Golph3l G A 3: 95,607,949 R134Q probably damaging Het
Hmgxb4 A G 8: 75,000,937 T183A probably damaging Het
Krt2 T G 15: 101,817,663 S147R unknown Het
Lipn T C 19: 34,076,979 S206P probably damaging Het
Mcpt2 A G 14: 56,043,679 probably null Het
Metap2 T C 10: 93,879,567 E133G probably benign Het
Nuak1 T C 10: 84,374,784 Y480C probably damaging Het
Oma1 C T 4: 103,325,299 Q300* probably null Het
Pcnt T C 10: 76,381,364 E2161G probably damaging Het
Pkdrej G T 15: 85,818,074 D1220E probably benign Het
Ptdss1 T A 13: 66,987,850 C390* probably null Het
Sars A C 3: 108,428,266 F389V possibly damaging Het
Sec31b C T 19: 44,524,506 V515M probably damaging Het
Syt3 A G 7: 44,399,147 E587G probably benign Het
Tjp2 T C 19: 24,122,272 E417G possibly damaging Het
Tmem63b A G 17: 45,666,115 F442S possibly damaging Het
Togaram1 A G 12: 64,982,698 D965G possibly damaging Het
Zmynd10 T C 9: 107,548,683 V72A probably damaging Het
Other mutations in Btn2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Btn2a2 APN 13 23478576 missense probably damaging 1.00
IGL00740:Btn2a2 APN 13 23478485 missense probably benign
IGL02053:Btn2a2 APN 13 23478820 missense probably damaging 1.00
IGL02720:Btn2a2 APN 13 23480467 missense probably benign 0.15
IGL02738:Btn2a2 APN 13 23478806 nonsense probably null
IGL03010:Btn2a2 APN 13 23486205 nonsense probably null
IGL03221:Btn2a2 APN 13 23478449 missense probably damaging 1.00
R0066:Btn2a2 UTSW 13 23478485 missense probably benign 0.01
R0066:Btn2a2 UTSW 13 23478485 missense probably benign 0.01
R0597:Btn2a2 UTSW 13 23486410 missense probably benign 0.12
R1209:Btn2a2 UTSW 13 23480566 critical splice donor site probably null
R1283:Btn2a2 UTSW 13 23478832 missense probably damaging 0.98
R1718:Btn2a2 UTSW 13 23481936 missense probably benign 0.01
R2925:Btn2a2 UTSW 13 23481814 missense probably damaging 1.00
R3824:Btn2a2 UTSW 13 23480465 missense probably benign 0.02
R5281:Btn2a2 UTSW 13 23478832 missense probably damaging 0.98
R5356:Btn2a2 UTSW 13 23482875 missense probably benign 0.02
R5482:Btn2a2 UTSW 13 23486387 missense probably benign 0.03
R5535:Btn2a2 UTSW 13 23478275 missense probably benign 0.14
R5629:Btn2a2 UTSW 13 23481960 splice site probably null
R5930:Btn2a2 UTSW 13 23486228 missense probably damaging 0.96
R5952:Btn2a2 UTSW 13 23482808 missense probably benign 0.09
R6006:Btn2a2 UTSW 13 23486363 missense probably damaging 1.00
R6196:Btn2a2 UTSW 13 23487845 missense possibly damaging 0.74
R6373:Btn2a2 UTSW 13 23481829 missense probably benign 0.00
R6533:Btn2a2 UTSW 13 23481781 nonsense probably null
R6891:Btn2a2 UTSW 13 23482844 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGCAATAGTCCCCTAAGACTGGCTC -3'
(R):5'- AATGGCTTCTGGACCCTGGAGATG -3'

Sequencing Primer
(F):5'- ATGCTCCATGTGATCTGAAGGAC -3'
(R):5'- ACCCTGGAGATGTTTGGAAGC -3'
Posted On2013-09-30