Incidental Mutation 'N/A:1700016C15Rik'
List |< first << previous [record 62 of 32981] next >> last >|
ID1
Institutional Source Beutler Lab
Gene Symbol 1700016C15Rik
Ensembl Gene ENSMUSG00000015962
Gene NameRIKEN cDNA 1700016C15 gene
Synonyms
Accession Numbers

Genbank: NM_027077; MGI: 1916678

Is this an essential gene? Not available question?
Stock #N/A of strain 294
Quality Score
Status Validated
Chromosome1
Chromosomal Location177729814-177753324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 177733534 bp
ZygosityHomozygous
Amino Acid Change Arginine to Histidine at position 13 (R13H)
Ref Sequence ENSEMBL: ENSMUSP00000016106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016106]
Predicted Effect probably damaging
Transcript: ENSMUST00000016106
AA Change: R13H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000016106
Gene: ENSMUSG00000015962
AA Change: R13H

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 88.7%
  • 3x: 76.0%
Validation Efficiency 91% (106/116)
Allele List at MGI

none

Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016P04Rik T A 6: 13,415,773 Homo
1810020O05Rik A T 6: 87,690,791 Homo
Aif1 A G 17: 35,172,520 L7S possibly damaging Homo
Ankrd26 T C 6: 118,529,574 D646G probably benign Homo
Cacna1s A G 1: 136,073,509 I233V probably benign Homo
Chchd4 T C 6: 91,465,205 Y77C probably damaging Homo
Crocc G A 4: 141,021,746 R1419C probably damaging Homo
Cyp4f39 A C 17: 32,468,681 M74L probably benign Homo
Fgf9 C A 14: 58,089,964 probably benign Homo
Gimap6 T C 6: 48,702,415 D229G probably damaging Homo
Glp1r T C 17: 30,931,283 F393S probably damaging Homo
Lrrc7 T G 3: 158,160,340 I1255L probably benign Homo
Mtrr C A 13: 68,575,397 probably benign Homo
Pde6b A T 5: 108,429,103 probably benign Homo
Rbm19 A T 5: 120,144,097 I840F probably damaging Homo
Serpina3c A C 12: 104,149,605 S227A probably benign Homo
Spag17 G A 3: 99,982,254 probably benign Homo
Zbtb8b T C 4: 129,432,568 D268G probably benign Homo
Other mutations in 1700016C15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:1700016C15Rik APN 1 177741074 missense probably benign
IGL01542:1700016C15Rik APN 1 177743384 missense possibly damaging 0.94
IGL02329:1700016C15Rik APN 1 177743301 missense probably benign 0.05
R0850:1700016C15Rik UTSW 1 177741005 missense probably benign
Nature of Mutation
DNA sequencing using the SOLiD technique identified a G to A transition at position 208 of the 1700016C15Rik transcript, in exon 2 of 6 total exons (Figure 1).
 
192 GAATTTGTAGAGCGTCGCCCATCGATTCCACCT
8   -E--F--V--E--R--R--P--S--I--P--P-
 
The mutated nucleotide is indicated in red lettering, and causes an arginine to histidine substitution at amino acid 13 of the encoded protein. The mutation has been confirmed by DNA sequencing using the Sanger method (Figure 2).
Protein Function and Prediction
1700016C15Rik is an uncharacterized gene with evidence at the transcript level for the existence of the encoded protein (Uniprot Q9DAA7). No similarity to known domain families is identified in the predicted protein sequence by the SMART program. The R13H mutation is predicted to be possibly damaging by the PolyPhen program.
Posted On2009-10-27