Incidental Mutation 'R1220:Col1a1'
ID100025
Institutional Source Beutler Lab
Gene Symbol Col1a1
Ensembl Gene ENSMUSG00000001506
Gene Namecollagen, type I, alpha 1
SynonymsCola1, Mov-13, Col1a-1, Cola-1
MMRRC Submission 039289-MU
Accession Numbers

MGI: 88467

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1220 (G1)
Quality Score149
Status Validated
Chromosome11
Chromosomal Location94936224-94953042 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 94951131 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 1335 (A1335S)
Ref Sequence ENSEMBL: ENSMUSP00000001547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001547]
Predicted Effect unknown
Transcript: ENSMUST00000001547
AA Change: A1335S
SMART Domains Protein: ENSMUSP00000001547
Gene: ENSMUSG00000001506
AA Change: A1335S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWC 31 86 1.04e-16 SMART
Pfam:Collagen 97 154 1.1e-9 PFAM
Pfam:Collagen 166 227 7e-10 PFAM
Pfam:Collagen 225 284 2.4e-13 PFAM
Pfam:Collagen 285 344 5.9e-12 PFAM
low complexity region 354 426 N/A INTRINSIC
internal_repeat_4 427 444 4.93e-7 PROSPERO
low complexity region 447 486 N/A INTRINSIC
low complexity region 495 516 N/A INTRINSIC
low complexity region 527 567 N/A INTRINSIC
internal_repeat_3 570 588 1.25e-9 PROSPERO
low complexity region 590 600 N/A INTRINSIC
low complexity region 603 627 N/A INTRINSIC
low complexity region 629 651 N/A INTRINSIC
internal_repeat_1 652 675 6.29e-11 PROSPERO
internal_repeat_4 658 675 4.93e-7 PROSPERO
low complexity region 678 699 N/A INTRINSIC
low complexity region 702 717 N/A INTRINSIC
internal_repeat_2 718 738 2.08e-10 PROSPERO
internal_repeat_1 718 741 6.29e-11 PROSPERO
internal_repeat_3 726 744 1.25e-9 PROSPERO
internal_repeat_5 737 752 9.8e-6 PROSPERO
Pfam:Collagen 768 827 2.8e-12 PFAM
Pfam:Collagen 828 887 6.8e-11 PFAM
internal_repeat_5 944 959 9.8e-6 PROSPERO
internal_repeat_2 952 972 2.08e-10 PROSPERO
Pfam:Collagen 1008 1077 4.8e-8 PFAM
Pfam:Collagen 1068 1127 1.2e-12 PFAM
Pfam:Collagen 1122 1184 2.8e-9 PFAM
PDB:3HR2|C 1185 1205 6e-6 PDB
COLFI 1217 1453 2.04e-162 SMART
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the fibril-forming type I collagen, the most abundant protein of bone, skin and tendon extracellular matrices. The encoded protein, in association with alpha-2 subunit, forms heterotrimeric type I procollagen that undergoes proteolytic processing during fibril formation. Mice lacking the encoded protein die in utero caused by the rupture of a major blood vessel. Transgenic mice expressing significantly lower levels of this gene exhibit morphological and functional defects in mineralized and non-mineralized connective tissue and, progressive loss of hearing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutations in this locus cause variable phenotype, from embryonic lethal to viable/fertile with altered fibrillogenesis. Homozygotes can show impaired bone formation and fragility, osteoporosis, dermal fibrosis, impaired uterine postpartum involution, andaortic dissection. [provided by MGI curators]
Allele List at MGI

All alleles(46) : Targeted(40) Gene trapped(3) Transgenic(1) Chemically induced(2)

Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C A 7: 119,658,314 S407R probably benign Het
Add2 A T 6: 86,087,000 M94L possibly damaging Het
Anks6 A T 4: 47,025,767 probably benign Het
Atxn1 A G 13: 45,557,423 S678P probably benign Het
Ccnc A G 4: 21,732,491 Y76C probably damaging Het
Col25a1 G T 3: 130,388,925 probably benign Het
Commd10 C A 18: 47,087,040 Q195K probably damaging Het
Cps1 G A 1: 67,204,703 probably null Het
Cramp1l A T 17: 24,982,237 V757D probably damaging Het
Cttn T C 7: 144,463,962 T13A probably benign Het
Eftud2 A G 11: 102,851,747 probably benign Het
Eif4enif1 A G 11: 3,239,493 probably benign Het
Exoc3l2 T A 7: 19,491,784 probably benign Het
Fam118b T C 9: 35,223,673 S213G possibly damaging Het
Katnal1 G A 5: 148,894,251 A171V probably benign Het
Lrig3 A G 10: 125,997,076 N273S probably damaging Het
Lrriq1 G A 10: 103,071,129 R1577W probably benign Het
Olfr385 A C 11: 73,589,377 Y120* probably null Het
Olfr495 T A 7: 108,395,332 S71T probably benign Het
Pmel A G 10: 128,714,060 D30G probably benign Het
Ppp1r15a T C 7: 45,523,869 Y505C probably damaging Het
Prpf40b C T 15: 99,316,348 R830C probably benign Het
Rabgap1l A T 1: 160,738,909 D106E probably damaging Het
Rad18 C A 6: 112,649,664 E141* probably null Het
Ros1 C T 10: 52,098,870 V1540M probably damaging Het
Secisbp2 G A 13: 51,656,905 R201H probably damaging Het
Shisa6 A G 11: 66,220,010 S302P probably damaging Het
Slamf9 C A 1: 172,477,331 Q171K probably benign Het
Sox6 T A 7: 115,662,442 T180S probably damaging Het
Ttn T C 2: 76,723,654 S30902G possibly damaging Het
Xirp1 A G 9: 120,017,916 F634L possibly damaging Het
Yrdc T A 4: 124,854,536 S278T possibly damaging Het
Other mutations in Col1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Col1a1 APN 11 94949378 missense unknown
IGL01383:Col1a1 APN 11 94945525 missense probably damaging 1.00
IGL01717:Col1a1 APN 11 94950777 missense unknown
IGL02889:Col1a1 APN 11 94951509 missense unknown
seal UTSW 11 94947184 splice site probably benign
walrus UTSW 11 94942385 missense unknown
R0121:Col1a1 UTSW 11 94938069 missense unknown
R0400:Col1a1 UTSW 11 94941369 splice site probably benign
R0545:Col1a1 UTSW 11 94951594 missense unknown
R0661:Col1a1 UTSW 11 94949389 missense unknown
R1717:Col1a1 UTSW 11 94948392 missense unknown
R1732:Col1a1 UTSW 11 94944415 splice site probably benign
R1879:Col1a1 UTSW 11 94951225 missense unknown
R1880:Col1a1 UTSW 11 94950568 missense unknown
R1901:Col1a1 UTSW 11 94946632 splice site probably null
R2113:Col1a1 UTSW 11 94948362 missense unknown
R2386:Col1a1 UTSW 11 94950391 missense unknown
R3803:Col1a1 UTSW 11 94938069 missense unknown
R4839:Col1a1 UTSW 11 94950095 critical splice acceptor site probably null
R4936:Col1a1 UTSW 11 94947132 missense unknown
R5081:Col1a1 UTSW 11 94951576 missense unknown
R5105:Col1a1 UTSW 11 94942385 missense unknown
R5110:Col1a1 UTSW 11 94941593 critical splice donor site probably null
R5247:Col1a1 UTSW 11 94947187 splice site probably null
R5773:Col1a1 UTSW 11 94939429 missense probably benign 0.10
R5776:Col1a1 UTSW 11 94949724 missense unknown
R5991:Col1a1 UTSW 11 94937919 missense unknown
R6415:Col1a1 UTSW 11 94940160 missense unknown
R6483:Col1a1 UTSW 11 94942618 splice site probably null
R7207:Col1a1 UTSW 11 94938526 missense unknown
Predicted Primers PCR Primer
(F):5'- TAACCAAGGCTGCAACCTGGAC -3'
(R):5'- TCCACAAGGGTGCTGTAGGTGAAG -3'

Sequencing Primer
(F):5'- TCTGTGCCTCAGAAGAACTG -3'
(R):5'- AAGCGACTGTTGCCTTCG -3'
Posted On2014-01-15