Incidental Mutation 'R1177:Chgb'
ID100035
Institutional Source Beutler Lab
Gene Symbol Chgb
Ensembl Gene ENSMUSG00000027350
Gene Namechromogranin B
Synonymssecretogranin I, Scg-1
MMRRC Submission 039249-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R1177 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location132781278-132795079 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132793470 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 444 (Y444C)
Ref Sequence ENSEMBL: ENSMUSP00000028826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028826]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028826
AA Change: Y444C

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028826
Gene: ENSMUSG00000027350
AA Change: Y444C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Granin 26 677 8.1e-238 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 94.9%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine-sulfated secretory protein abundant in peptidergic endocrine cells and neurons. This protein may serve as a precursor for regulatory peptides. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced catecholamine secretion from adrenal chromaffin cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bbs7 A T 3: 36,610,180 probably null Het
Bivm G A 1: 44,142,963 V444I probably benign Het
Cers4 A G 8: 4,516,931 I78V probably null Het
Col7a1 T C 9: 108,962,441 V1161A unknown Het
Dpp6 A G 5: 27,663,473 D478G possibly damaging Het
Eif4enif1 T C 11: 3,229,902 V274A probably damaging Het
Fkrp T C 7: 16,810,527 E470G probably damaging Het
Lrrc8c T C 5: 105,606,836 I159T probably benign Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k21 A T 8: 125,944,838 Q955L probably benign Het
Mast3 A G 8: 70,780,324 S1115P probably damaging Het
Mga T C 2: 119,926,446 F1048S probably damaging Het
Mthfd1l A C 10: 3,985,661 K212T possibly damaging Het
Myo5b G A 18: 74,644,072 R401H probably damaging Het
Naip1 C T 13: 100,427,064 S531N possibly damaging Het
Nlrp1a A G 11: 71,107,721 V884A probably damaging Het
Nop58 T A 1: 59,700,932 M161K probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup210l A G 3: 90,202,003 T1618A probably benign Het
Olfr1202 A G 2: 88,817,360 Y63C probably benign Het
Olfr124 A T 17: 37,805,952 E269V probably benign Het
Olfr963 A G 9: 39,669,641 R195G probably benign Het
Ppp4r4 G A 12: 103,576,323 A115T possibly damaging Het
Rag1 T C 2: 101,642,278 R840G probably benign Het
Slc44a2 A T 9: 21,348,583 Q629L probably benign Het
Slc5a6 A G 5: 31,039,302 probably null Het
Spag1 A T 15: 36,234,767 T859S probably benign Het
Sv2c G T 13: 95,989,763 A327E possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tlr2 A G 3: 83,838,734 I14T probably benign Het
Trpc6 G A 9: 8,658,304 R725K probably benign Het
Wdr90 A G 17: 25,846,054 V1688A possibly damaging Het
Zfhx4 ACCTCCTCCTCCTCCTCCTCC ACCTCCTCCTCCTCCTCC 3: 5,400,831 probably benign Het
Zfp94 T C 7: 24,303,528 Y163C probably damaging Het
Other mutations in Chgb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01601:Chgb APN 2 132793491 missense probably benign 0.00
IGL03031:Chgb APN 2 132793514 missense probably benign 0.03
R0317:Chgb UTSW 2 132793811 missense probably benign 0.06
R0513:Chgb UTSW 2 132785977 splice site probably benign
R0607:Chgb UTSW 2 132793335 missense probably benign
R1468:Chgb UTSW 2 132792800 missense probably benign 0.00
R1468:Chgb UTSW 2 132792800 missense probably benign 0.00
R1595:Chgb UTSW 2 132793737 missense probably benign 0.22
R1994:Chgb UTSW 2 132786498 missense possibly damaging 0.93
R3861:Chgb UTSW 2 132793144 missense probably damaging 0.99
R4074:Chgb UTSW 2 132793927 missense possibly damaging 0.48
R4354:Chgb UTSW 2 132793944 missense probably damaging 1.00
R4815:Chgb UTSW 2 132793299 missense probably benign 0.27
R4983:Chgb UTSW 2 132793682 missense probably damaging 1.00
R5426:Chgb UTSW 2 132793533 missense possibly damaging 0.63
R5711:Chgb UTSW 2 132792698 missense probably benign 0.00
R5946:Chgb UTSW 2 132792596 missense probably benign
R7116:Chgb UTSW 2 132781317 start gained probably benign
Predicted Primers
Posted On2014-01-15