Incidental Mutation 'R1177:Dpp6'
ID100044
Institutional Source Beutler Lab
Gene Symbol Dpp6
Ensembl Gene ENSMUSG00000061576
Gene Namedipeptidylpeptidase 6
SynonymsRw, LOC384168, Peplb, Dpp-6, B930011P16Rik, In(5)6H-p
MMRRC Submission 039249-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R1177 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location26817203-27727505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27663473 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 478 (D478G)
Ref Sequence ENSEMBL: ENSMUSP00000113441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071500] [ENSMUST00000101471] [ENSMUST00000120555] [ENSMUST00000122171]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071500
AA Change: D423G

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000071435
Gene: ENSMUSG00000061576
AA Change: D423G

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
Pfam:DPPIV_N 134 500 7.2e-114 PFAM
Pfam:PD40 365 402 1.1e-5 PFAM
Pfam:Peptidase_S9 579 789 2.9e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000101471
AA Change: D422G

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099012
Gene: ENSMUSG00000061576
AA Change: D422G

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
Pfam:DPPIV_N 133 499 2.6e-114 PFAM
Pfam:PD40 364 401 9.3e-6 PFAM
Pfam:Peptidase_S9 578 788 1.9e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120555
AA Change: D420G

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113849
Gene: ENSMUSG00000061576
AA Change: D420G

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
Pfam:DPPIV_N 131 497 2.6e-114 PFAM
Pfam:PD40 362 399 9.2e-6 PFAM
Pfam:Peptidase_S9 576 786 1.9e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000122171
AA Change: D478G

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113441
Gene: ENSMUSG00000061576
AA Change: D478G

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
transmembrane domain 90 112 N/A INTRINSIC
Pfam:DPPIV_N 189 555 6.4e-113 PFAM
Pfam:PD40 425 457 1.1e-4 PFAM
Pfam:Peptidase_S9 634 844 4.3e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134175
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 94.9%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the peptidase S9B family of serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Variations in this gene may be associated with susceptibility to amyotrophic lateral sclerosis and with idiopathic ventricular fibrillation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit loss of A-type K+ current gradients in distal dendrites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bbs7 A T 3: 36,610,180 probably null Het
Bivm G A 1: 44,142,963 V444I probably benign Het
Cers4 A G 8: 4,516,931 I78V probably null Het
Chgb A G 2: 132,793,470 Y444C possibly damaging Het
Col7a1 T C 9: 108,962,441 V1161A unknown Het
Eif4enif1 T C 11: 3,229,902 V274A probably damaging Het
Fkrp T C 7: 16,810,527 E470G probably damaging Het
Lrrc8c T C 5: 105,606,836 I159T probably benign Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k21 A T 8: 125,944,838 Q955L probably benign Het
Mast3 A G 8: 70,780,324 S1115P probably damaging Het
Mga T C 2: 119,926,446 F1048S probably damaging Het
Mthfd1l A C 10: 3,985,661 K212T possibly damaging Het
Myo5b G A 18: 74,644,072 R401H probably damaging Het
Naip1 C T 13: 100,427,064 S531N possibly damaging Het
Nlrp1a A G 11: 71,107,721 V884A probably damaging Het
Nop58 T A 1: 59,700,932 M161K probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup210l A G 3: 90,202,003 T1618A probably benign Het
Olfr1202 A G 2: 88,817,360 Y63C probably benign Het
Olfr124 A T 17: 37,805,952 E269V probably benign Het
Olfr963 A G 9: 39,669,641 R195G probably benign Het
Ppp4r4 G A 12: 103,576,323 A115T possibly damaging Het
Rag1 T C 2: 101,642,278 R840G probably benign Het
Slc44a2 A T 9: 21,348,583 Q629L probably benign Het
Slc5a6 A G 5: 31,039,302 probably null Het
Spag1 A T 15: 36,234,767 T859S probably benign Het
Sv2c G T 13: 95,989,763 A327E possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tlr2 A G 3: 83,838,734 I14T probably benign Het
Trpc6 G A 9: 8,658,304 R725K probably benign Het
Wdr90 A G 17: 25,846,054 V1688A possibly damaging Het
Zfhx4 ACCTCCTCCTCCTCCTCCTCC ACCTCCTCCTCCTCCTCC 3: 5,400,831 probably benign Het
Zfp94 T C 7: 24,303,528 Y163C probably damaging Het
Other mutations in Dpp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Dpp6 APN 5 27723443 missense probably damaging 1.00
IGL01137:Dpp6 APN 5 27714488 missense probably damaging 1.00
IGL01386:Dpp6 APN 5 27664762 critical splice donor site probably null
IGL01409:Dpp6 APN 5 27557601 missense probably damaging 1.00
IGL01721:Dpp6 APN 5 27631520 missense probably damaging 1.00
IGL02149:Dpp6 APN 5 27538024 missense probably benign 0.00
IGL02174:Dpp6 APN 5 27721087 nonsense probably null
IGL02176:Dpp6 APN 5 27723577 missense probably damaging 0.98
IGL02326:Dpp6 APN 5 27664757 missense probably damaging 1.00
IGL02336:Dpp6 APN 5 27469411 missense probably benign 0.04
IGL02339:Dpp6 APN 5 27652230 missense probably damaging 0.97
IGL02402:Dpp6 APN 5 27634543 missense probably damaging 1.00
IGL02884:Dpp6 APN 5 27634556 missense possibly damaging 0.88
IGL02885:Dpp6 APN 5 27718473 missense probably damaging 1.00
IGL02938:Dpp6 APN 5 27723367 splice site probably benign
IGL03083:Dpp6 APN 5 27709550 critical splice donor site probably null
I0000:Dpp6 UTSW 5 27398922 missense probably benign 0.02
IGL03052:Dpp6 UTSW 5 27709508 missense probably benign 0.03
PIT4431001:Dpp6 UTSW 5 27631498 missense probably benign 0.03
R0060:Dpp6 UTSW 5 27598819 missense probably damaging 1.00
R0360:Dpp6 UTSW 5 27652269 missense probably damaging 1.00
R0486:Dpp6 UTSW 5 27661642 missense probably benign 0.39
R0501:Dpp6 UTSW 5 27725606 missense probably damaging 1.00
R1028:Dpp6 UTSW 5 27666427 missense probably benign 0.01
R1164:Dpp6 UTSW 5 27721105 missense probably benign 0.02
R1993:Dpp6 UTSW 5 27399006 missense probably benign 0.00
R2024:Dpp6 UTSW 5 27709459 missense possibly damaging 0.67
R2100:Dpp6 UTSW 5 27664744 missense probably damaging 0.96
R2329:Dpp6 UTSW 5 27451288 splice site probably null
R3619:Dpp6 UTSW 5 27721120 missense possibly damaging 0.74
R3871:Dpp6 UTSW 5 27469465 missense probably benign 0.03
R3872:Dpp6 UTSW 5 27721058 missense probably damaging 1.00
R4114:Dpp6 UTSW 5 27469487 critical splice donor site probably null
R4403:Dpp6 UTSW 5 27718462 missense probably damaging 1.00
R4599:Dpp6 UTSW 5 27634548 missense probably damaging 1.00
R4736:Dpp6 UTSW 5 27712659 missense probably damaging 1.00
R4929:Dpp6 UTSW 5 27049787 missense probably benign 0.25
R4967:Dpp6 UTSW 5 27666511 missense probably damaging 1.00
R5162:Dpp6 UTSW 5 27399015 unclassified probably benign
R5270:Dpp6 UTSW 5 27634534 missense probably damaging 0.98
R5334:Dpp6 UTSW 5 27709540 missense probably benign 0.30
R5437:Dpp6 UTSW 5 27663501 nonsense probably null
R5663:Dpp6 UTSW 5 27049622 missense possibly damaging 0.84
R6023:Dpp6 UTSW 5 27723547 missense probably damaging 0.96
R6244:Dpp6 UTSW 5 27049628 missense probably damaging 0.99
R6312:Dpp6 UTSW 5 27725671 missense possibly damaging 0.84
R6442:Dpp6 UTSW 5 27718509 critical splice donor site probably null
R6942:Dpp6 UTSW 5 27469459 missense possibly damaging 0.79
R6956:Dpp6 UTSW 5 27598821 missense probably damaging 1.00
R7210:Dpp6 UTSW 5 27598803 missense probably damaging 0.99
R7342:Dpp6 UTSW 5 27714554 missense probably benign
Predicted Primers
Posted On2014-01-15