Incidental Mutation 'R1177:Nrbp1'
ID100047
Institutional Source Beutler Lab
Gene Symbol Nrbp1
Ensembl Gene ENSMUSG00000029148
Gene Namenuclear receptor binding protein 1
SynonymsB230344L17Rik, Nrbp
MMRRC Submission 039249-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1177 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location31240864-31251566 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31245813 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 210 (I210N)
Ref Sequence ENSEMBL: ENSMUSP00000143872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031034] [ENSMUST00000068997] [ENSMUST00000201259] [ENSMUST00000202505] [ENSMUST00000202576] [ENSMUST00000202842]
Predicted Effect probably damaging
Transcript: ENSMUST00000031034
AA Change: I210N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031034
Gene: ENSMUSG00000029148
AA Change: I210N

DomainStartEndE-ValueType
low complexity region 27 60 N/A INTRINSIC
Pfam:Pkinase_Tyr 80 324 5.8e-26 PFAM
Pfam:Pkinase 80 327 1e-26 PFAM
low complexity region 412 436 N/A INTRINSIC
low complexity region 459 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068997
SMART Domains Protein: ENSMUSP00000070496
Gene: ENSMUSG00000055424

DomainStartEndE-ValueType
low complexity region 60 76 N/A INTRINSIC
low complexity region 78 101 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000078312
AA Change: I210N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077426
Gene: ENSMUSG00000029148
AA Change: I210N

DomainStartEndE-ValueType
low complexity region 27 60 N/A INTRINSIC
Pfam:Pkinase 79 335 1e-24 PFAM
Pfam:Pkinase_Tyr 81 332 6.5e-25 PFAM
low complexity region 420 444 N/A INTRINSIC
low complexity region 467 484 N/A INTRINSIC
Predicted Effect not run
Transcript: ENSMUST00000139602
AA Change: I194N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141973
AA Change: S309T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201070
Predicted Effect probably benign
Transcript: ENSMUST00000201259
Predicted Effect probably damaging
Transcript: ENSMUST00000202505
AA Change: I125N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144292
Gene: ENSMUSG00000029148
AA Change: I125N

DomainStartEndE-ValueType
STYKc 14 184 1.3e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202576
AA Change: I210N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143872
Gene: ENSMUSG00000029148
AA Change: I210N

DomainStartEndE-ValueType
low complexity region 27 60 N/A INTRINSIC
Pfam:Pkinase 79 335 1e-24 PFAM
Pfam:Pkinase_Tyr 81 332 6.5e-25 PFAM
low complexity region 420 444 N/A INTRINSIC
low complexity region 467 484 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202801
Predicted Effect probably benign
Transcript: ENSMUST00000202842
SMART Domains Protein: ENSMUSP00000143899
Gene: ENSMUSG00000029148

DomainStartEndE-ValueType
Pfam:Pkinase 2 88 4.8e-5 PFAM
Pfam:Pkinase_Tyr 3 88 1.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202982
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 94.9%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality at E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bbs7 A T 3: 36,610,180 probably null Het
Bivm G A 1: 44,142,963 V444I probably benign Het
Cers4 A G 8: 4,516,931 I78V probably null Het
Chgb A G 2: 132,793,470 Y444C possibly damaging Het
Col7a1 T C 9: 108,962,441 V1161A unknown Het
Dpp6 A G 5: 27,663,473 D478G possibly damaging Het
Eif4enif1 T C 11: 3,229,902 V274A probably damaging Het
Fkrp T C 7: 16,810,527 E470G probably damaging Het
Lrrc8c T C 5: 105,606,836 I159T probably benign Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k21 A T 8: 125,944,838 Q955L probably benign Het
Mast3 A G 8: 70,780,324 S1115P probably damaging Het
Mga T C 2: 119,926,446 F1048S probably damaging Het
Mthfd1l A C 10: 3,985,661 K212T possibly damaging Het
Myo5b G A 18: 74,644,072 R401H probably damaging Het
Naip1 C T 13: 100,427,064 S531N possibly damaging Het
Nlrp1a A G 11: 71,107,721 V884A probably damaging Het
Nop58 T A 1: 59,700,932 M161K probably damaging Het
Nup210l A G 3: 90,202,003 T1618A probably benign Het
Olfr1202 A G 2: 88,817,360 Y63C probably benign Het
Olfr124 A T 17: 37,805,952 E269V probably benign Het
Olfr963 A G 9: 39,669,641 R195G probably benign Het
Ppp4r4 G A 12: 103,576,323 A115T possibly damaging Het
Rag1 T C 2: 101,642,278 R840G probably benign Het
Slc44a2 A T 9: 21,348,583 Q629L probably benign Het
Slc5a6 A G 5: 31,039,302 probably null Het
Spag1 A T 15: 36,234,767 T859S probably benign Het
Sv2c G T 13: 95,989,763 A327E possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tlr2 A G 3: 83,838,734 I14T probably benign Het
Trpc6 G A 9: 8,658,304 R725K probably benign Het
Wdr90 A G 17: 25,846,054 V1688A possibly damaging Het
Zfhx4 ACCTCCTCCTCCTCCTCCTCC ACCTCCTCCTCCTCCTCC 3: 5,400,831 probably benign Het
Zfp94 T C 7: 24,303,528 Y163C probably damaging Het
Other mutations in Nrbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Nrbp1 APN 5 31251059 missense possibly damaging 0.74
IGL00926:Nrbp1 APN 5 31243797 missense probably benign 0.07
Ghetto UTSW 5 31245846 critical splice donor site probably null
pudong UTSW 5 31250137 missense probably damaging 1.00
Shanghai UTSW 5 31245813 missense probably damaging 1.00
R0358:Nrbp1 UTSW 5 31244887 missense probably damaging 1.00
R0993:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1139:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1179:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1180:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1193:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1194:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1196:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1267:Nrbp1 UTSW 5 31250590 missense probably benign 0.00
R1302:Nrbp1 UTSW 5 31249889 missense probably benign 0.00
R1320:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1321:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1322:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1323:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1323:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1324:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1325:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1341:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1388:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1411:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1448:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1697:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1815:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1816:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1950:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1987:Nrbp1 UTSW 5 31245391 missense probably damaging 1.00
R2079:Nrbp1 UTSW 5 31251073 missense probably benign 0.08
R2142:Nrbp1 UTSW 5 31247929 missense possibly damaging 0.95
R4299:Nrbp1 UTSW 5 31250599 critical splice donor site probably null
R5115:Nrbp1 UTSW 5 31243715 nonsense probably null
R5168:Nrbp1 UTSW 5 31250137 missense probably damaging 1.00
R5640:Nrbp1 UTSW 5 31249585 missense possibly damaging 0.96
R6765:Nrbp1 UTSW 5 31245846 critical splice donor site probably null
R7022:Nrbp1 UTSW 5 31244481 missense probably damaging 1.00
R7044:Nrbp1 UTSW 5 31249946 missense probably damaging 0.98
R7439:Nrbp1 UTSW 5 31244956 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCCAGTTTCTTTGAGTCACAT -3'
(R):5'- ACCTCAAAATTTGCTGTTCTCCC -3'

Sequencing Primer
(F):5'- CATGCTGACAAGATTAGACC -3'
(R):5'- CCCATGCCTTTTATCTTACC -3'
Posted On2014-01-15