Incidental Mutation 'R1177:Lrrc8c'
ID100049
Institutional Source Beutler Lab
Gene Symbol Lrrc8c
Ensembl Gene ENSMUSG00000054720
Gene Nameleucine rich repeat containing 8 family, member C
SynonymsE430036I04Rik
MMRRC Submission 039249-MU
Accession Numbers

NCBI RefSeq: NM_133897.2; MGI:2140839

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1177 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location105519388-105613018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105606836 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 159 (I159T)
Ref Sequence ENSEMBL: ENSMUSP00000114899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067924] [ENSMUST00000153754]
Predicted Effect probably benign
Transcript: ENSMUST00000067924
AA Change: I159T

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000066015
Gene: ENSMUSG00000054720
AA Change: I159T

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 338 5.7e-152 PFAM
low complexity region 398 407 N/A INTRINSIC
LRR 588 611 3.97e0 SMART
LRR 613 635 1.81e2 SMART
LRR 636 658 2.2e1 SMART
LRR_TYP 659 682 1.45e-2 SMART
LRR 684 703 3.56e2 SMART
LRR 705 728 2.92e1 SMART
LRR 751 774 1.09e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153754
AA Change: I159T

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114899
Gene: ENSMUSG00000054720
AA Change: I159T

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 4.8e-35 PFAM
low complexity region 78 93 N/A INTRINSIC
Pfam:DUF3733 99 158 1.7e-26 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 94.9%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction in body weight, white adipose tissue weight, and insulin resistance on a high-fat diet, indicating protection from diet-induced obesity and insulin resistance. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bbs7 A T 3: 36,610,180 probably null Het
Bivm G A 1: 44,142,963 V444I probably benign Het
Cers4 A G 8: 4,516,931 I78V probably null Het
Chgb A G 2: 132,793,470 Y444C possibly damaging Het
Col7a1 T C 9: 108,962,441 V1161A unknown Het
Dpp6 A G 5: 27,663,473 D478G possibly damaging Het
Eif4enif1 T C 11: 3,229,902 V274A probably damaging Het
Fkrp T C 7: 16,810,527 E470G probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k21 A T 8: 125,944,838 Q955L probably benign Het
Mast3 A G 8: 70,780,324 S1115P probably damaging Het
Mga T C 2: 119,926,446 F1048S probably damaging Het
Mthfd1l A C 10: 3,985,661 K212T possibly damaging Het
Myo5b G A 18: 74,644,072 R401H probably damaging Het
Naip1 C T 13: 100,427,064 S531N possibly damaging Het
Nlrp1a A G 11: 71,107,721 V884A probably damaging Het
Nop58 T A 1: 59,700,932 M161K probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup210l A G 3: 90,202,003 T1618A probably benign Het
Olfr1202 A G 2: 88,817,360 Y63C probably benign Het
Olfr124 A T 17: 37,805,952 E269V probably benign Het
Olfr963 A G 9: 39,669,641 R195G probably benign Het
Ppp4r4 G A 12: 103,576,323 A115T possibly damaging Het
Rag1 T C 2: 101,642,278 R840G probably benign Het
Slc44a2 A T 9: 21,348,583 Q629L probably benign Het
Slc5a6 A G 5: 31,039,302 probably null Het
Spag1 A T 15: 36,234,767 T859S probably benign Het
Sv2c G T 13: 95,989,763 A327E possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tlr2 A G 3: 83,838,734 I14T probably benign Het
Trpc6 G A 9: 8,658,304 R725K probably benign Het
Wdr90 A G 17: 25,846,054 V1688A possibly damaging Het
Zfhx4 ACCTCCTCCTCCTCCTCCTCC ACCTCCTCCTCCTCCTCC 3: 5,400,831 probably benign Het
Zfp94 T C 7: 24,303,528 Y163C probably damaging Het
Other mutations in Lrrc8c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Lrrc8c APN 5 105607210 missense probably damaging 0.99
IGL00736:Lrrc8c APN 5 105607114 missense probably damaging 1.00
IGL00822:Lrrc8c APN 5 105608308 missense probably benign 0.04
IGL02009:Lrrc8c APN 5 105607391 missense probably damaging 1.00
IGL02156:Lrrc8c APN 5 105607493 missense probably damaging 1.00
IGL02266:Lrrc8c APN 5 105608248 missense probably benign 0.30
IGL02268:Lrrc8c APN 5 105607898 missense probably damaging 1.00
IGL02487:Lrrc8c APN 5 105606591 missense probably benign
IGL02536:Lrrc8c APN 5 105607172 missense probably benign 0.00
IGL02672:Lrrc8c APN 5 105607358 missense possibly damaging 0.85
IGL02860:Lrrc8c APN 5 105579615 splice site probably benign
IGL03395:Lrrc8c APN 5 105606629 missense probably benign
P0014:Lrrc8c UTSW 5 105607244 missense probably benign 0.06
PIT4504001:Lrrc8c UTSW 5 105608537 missense probably benign
PIT4651001:Lrrc8c UTSW 5 105608323 missense probably benign 0.04
R0196:Lrrc8c UTSW 5 105606770 missense probably benign 0.18
R0454:Lrrc8c UTSW 5 105607099 missense probably damaging 1.00
R0565:Lrrc8c UTSW 5 105607028 missense probably damaging 0.98
R0673:Lrrc8c UTSW 5 105607678 missense probably damaging 0.99
R0722:Lrrc8c UTSW 5 105579548 missense probably damaging 1.00
R0815:Lrrc8c UTSW 5 105608534 missense probably damaging 1.00
R1411:Lrrc8c UTSW 5 105608179 missense probably damaging 0.96
R1486:Lrrc8c UTSW 5 105607529 missense probably damaging 1.00
R1551:Lrrc8c UTSW 5 105608224 missense probably damaging 1.00
R1662:Lrrc8c UTSW 5 105606757 missense probably benign 0.22
R1714:Lrrc8c UTSW 5 105607291 missense possibly damaging 0.93
R1770:Lrrc8c UTSW 5 105606737 missense probably damaging 1.00
R2104:Lrrc8c UTSW 5 105607358 missense possibly damaging 0.85
R2139:Lrrc8c UTSW 5 105606692 missense probably damaging 1.00
R4425:Lrrc8c UTSW 5 105607889 missense probably benign 0.22
R4670:Lrrc8c UTSW 5 105608374 missense probably benign
R4897:Lrrc8c UTSW 5 105608089 missense probably benign 0.01
R4968:Lrrc8c UTSW 5 105607127 missense probably damaging 1.00
R5114:Lrrc8c UTSW 5 105607483 missense probably damaging 1.00
R5580:Lrrc8c UTSW 5 105607687 missense probably benign 0.00
R5804:Lrrc8c UTSW 5 105579557 missense possibly damaging 0.88
R5918:Lrrc8c UTSW 5 105608251 missense possibly damaging 0.68
R6293:Lrrc8c UTSW 5 105606746 missense probably damaging 1.00
R6303:Lrrc8c UTSW 5 105608609 missense probably benign 0.31
R6304:Lrrc8c UTSW 5 105608609 missense probably benign 0.31
R7271:Lrrc8c UTSW 5 105607987 missense probably benign 0.02
Predicted Primers
Posted On2014-01-15