Incidental Mutation 'R1177:Cers4'
ID100057
Institutional Source Beutler Lab
Gene Symbol Cers4
Ensembl Gene ENSMUSG00000008206
Gene Nameceramide synthase 4
SynonymsLass4, CerS4, Trh1, 2900019C14Rik
MMRRC Submission 039249-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1177 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location4493026-4531680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4516931 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 78 (I78V)
Ref Sequence ENSEMBL: ENSMUSP00000008350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008350] [ENSMUST00000176042] [ENSMUST00000176130]
Predicted Effect probably null
Transcript: ENSMUST00000008350
AA Change: I78V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000008350
Gene: ENSMUSG00000008206
AA Change: I78V

DomainStartEndE-ValueType
low complexity region 39 52 N/A INTRINSIC
HOX 75 132 2.42e-2 SMART
TLC 131 332 2.74e-82 SMART
low complexity region 342 357 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175781
SMART Domains Protein: ENSMUSP00000138819
Gene: ENSMUSG00000008206

DomainStartEndE-ValueType
low complexity region 39 52 N/A INTRINSIC
HOX 75 132 2.42e-2 SMART
TLC 131 332 2.74e-82 SMART
low complexity region 342 357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176042
SMART Domains Protein: ENSMUSP00000135594
Gene: ENSMUSG00000008206

DomainStartEndE-ValueType
Blast:TLC 4 38 4e-9 BLAST
low complexity region 39 52 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176130
AA Change: I78V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000135652
Gene: ENSMUSG00000008206
AA Change: I78V

DomainStartEndE-ValueType
transmembrane domain 39 56 N/A INTRINSIC
HOX 75 132 1.2e-4 SMART
transmembrane domain 140 162 N/A INTRINSIC
transmembrane domain 177 199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177010
SMART Domains Protein: ENSMUSP00000135763
Gene: ENSMUSG00000008206

DomainStartEndE-ValueType
Blast:TLC 4 58 7e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193830
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 94.9%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered lipid composition of the sebum and hair follicle dystrophy that results in a progressive form of alopecia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bbs7 A T 3: 36,610,180 probably null Het
Bivm G A 1: 44,142,963 V444I probably benign Het
Chgb A G 2: 132,793,470 Y444C possibly damaging Het
Col7a1 T C 9: 108,962,441 V1161A unknown Het
Dpp6 A G 5: 27,663,473 D478G possibly damaging Het
Eif4enif1 T C 11: 3,229,902 V274A probably damaging Het
Fkrp T C 7: 16,810,527 E470G probably damaging Het
Lrrc8c T C 5: 105,606,836 I159T probably benign Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k21 A T 8: 125,944,838 Q955L probably benign Het
Mast3 A G 8: 70,780,324 S1115P probably damaging Het
Mga T C 2: 119,926,446 F1048S probably damaging Het
Mthfd1l A C 10: 3,985,661 K212T possibly damaging Het
Myo5b G A 18: 74,644,072 R401H probably damaging Het
Naip1 C T 13: 100,427,064 S531N possibly damaging Het
Nlrp1a A G 11: 71,107,721 V884A probably damaging Het
Nop58 T A 1: 59,700,932 M161K probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup210l A G 3: 90,202,003 T1618A probably benign Het
Olfr1202 A G 2: 88,817,360 Y63C probably benign Het
Olfr124 A T 17: 37,805,952 E269V probably benign Het
Olfr963 A G 9: 39,669,641 R195G probably benign Het
Ppp4r4 G A 12: 103,576,323 A115T possibly damaging Het
Rag1 T C 2: 101,642,278 R840G probably benign Het
Slc44a2 A T 9: 21,348,583 Q629L probably benign Het
Slc5a6 A G 5: 31,039,302 probably null Het
Spag1 A T 15: 36,234,767 T859S probably benign Het
Sv2c G T 13: 95,989,763 A327E possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tlr2 A G 3: 83,838,734 I14T probably benign Het
Trpc6 G A 9: 8,658,304 R725K probably benign Het
Wdr90 A G 17: 25,846,054 V1688A possibly damaging Het
Zfhx4 ACCTCCTCCTCCTCCTCCTCC ACCTCCTCCTCCTCCTCC 3: 5,400,831 probably benign Het
Zfp94 T C 7: 24,303,528 Y163C probably damaging Het
Other mutations in Cers4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Cers4 APN 8 4521216 missense probably benign 0.13
IGL02407:Cers4 APN 8 4520306 nonsense probably null
IGL03244:Cers4 APN 8 4516878 missense probably damaging 0.99
Radlauer UTSW 8 4519475 missense probably damaging 1.00
willis UTSW 8 4518269 nonsense probably null
R1170:Cers4 UTSW 8 4519475 missense probably damaging 1.00
R1346:Cers4 UTSW 8 4515632 missense probably damaging 1.00
R1506:Cers4 UTSW 8 4520557 missense probably benign 0.30
R1652:Cers4 UTSW 8 4516908 unclassified probably null
R1819:Cers4 UTSW 8 4521232 missense probably benign 0.00
R1952:Cers4 UTSW 8 4523461 nonsense probably null
R3790:Cers4 UTSW 8 4518285 missense possibly damaging 0.87
R4342:Cers4 UTSW 8 4521223 missense probably damaging 1.00
R5001:Cers4 UTSW 8 4515565 missense probably benign 0.33
R5338:Cers4 UTSW 8 4515680 missense probably damaging 0.98
R5785:Cers4 UTSW 8 4516992 critical splice donor site probably null
R5980:Cers4 UTSW 8 4518269 nonsense probably null
R6315:Cers4 UTSW 8 4516980 missense probably benign 0.02
R6891:Cers4 UTSW 8 4523731 missense probably damaging 0.99
Predicted Primers
Posted On2014-01-15