Incidental Mutation 'R1221:Osmr'
ID100141
Institutional Source Beutler Lab
Gene Symbol Osmr
Ensembl Gene ENSMUSG00000022146
Gene Nameoncostatin M receptor
SynonymsOSMRB
MMRRC Submission 039290-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R1221 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location6813577-6874969 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 6823561 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 617 (Q617*)
Ref Sequence ENSEMBL: ENSMUSP00000135204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022746] [ENSMUST00000176826]
Predicted Effect probably null
Transcript: ENSMUST00000022746
AA Change: Q618*
SMART Domains Protein: ENSMUSP00000022746
Gene: ENSMUSG00000022146
AA Change: Q618*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 35 N/A INTRINSIC
Blast:FN3 234 317 9e-38 BLAST
FN3 330 412 6.25e-3 SMART
FN3 427 512 2.75e0 SMART
FN3 523 607 7.02e1 SMART
FN3 619 720 3.17e-4 SMART
transmembrane domain 736 758 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176554
Predicted Effect probably null
Transcript: ENSMUST00000176826
AA Change: Q617*
SMART Domains Protein: ENSMUSP00000135204
Gene: ENSMUSG00000022146
AA Change: Q617*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 35 N/A INTRINSIC
Blast:FN3 234 317 9e-38 BLAST
FN3 330 412 6.25e-3 SMART
FN3 427 512 2.75e0 SMART
FN3 523 606 2.77e1 SMART
FN3 618 719 3.17e-4 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I cytokine receptor family. The encoded protein heterodimerizes with interleukin 6 signal transducer to form the type II oncostatin M receptor and with interleukin 31 receptor A to form the interleukin 31 receptor, and thus transduces oncostatin M and interleukin 31 induced signaling events. Mutations in this gene have been associated with familial primary localized cutaneous amyloidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit anemia, decreased hematocrit, and reduced erythroid progenitor, erythrocyte, platelet, and megakaryocyte cells. Homozygotes also show increased susceptibility to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,221 V255E probably benign Het
Aak1 T C 6: 86,965,478 S668P unknown Het
Anks1 A G 17: 28,050,642 Q770R possibly damaging Het
Apc2 G A 10: 80,306,380 V378I probably damaging Het
Apeh A G 9: 108,092,609 V184A probably benign Het
AU018091 A G 7: 3,158,877 F404S probably damaging Het
Bap1 T C 14: 31,257,651 L537P probably damaging Het
Bhlha15 A G 5: 144,191,523 Y151C probably damaging Het
Bmp8b A T 4: 123,114,711 T157S probably damaging Het
Btbd1 G T 7: 81,818,257 H172N possibly damaging Het
C1rl A G 6: 124,493,981 R83G probably benign Het
Cep104 A G 4: 153,988,445 T387A probably benign Het
Cfi A T 3: 129,872,969 Q447L probably damaging Het
Coq6 A G 12: 84,371,527 E295G possibly damaging Het
Dclre1a T C 19: 56,531,268 T978A possibly damaging Het
Dlc1 T C 8: 36,584,831 D582G probably benign Het
Dlgap2 A G 8: 14,726,952 T65A probably benign Het
Dock5 G A 14: 67,759,161 S1711L probably benign Het
Drc3 A C 11: 60,384,226 I338L probably benign Het
Dsc1 A T 18: 20,114,542 C5* probably null Het
F5 A G 1: 164,161,799 Y90C probably damaging Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Gm136 G T 4: 34,744,127 A239E possibly damaging Het
Gm4952 A T 19: 12,623,695 D93V possibly damaging Het
Gramd1c T C 16: 43,989,864 T454A possibly damaging Het
Gstm6 A G 3: 107,941,102 I58T probably damaging Het
Kdm3b C T 18: 34,808,245 S263L possibly damaging Het
Kdm5b G C 1: 134,599,091 S317T probably damaging Het
Myo15b A G 11: 115,886,720 R71G possibly damaging Het
Nlrp1b G A 11: 71,181,464 P518S probably benign Het
Nme5 A T 18: 34,571,522 I90N probably damaging Het
Nrxn1 T A 17: 90,643,294 T478S probably damaging Het
Odf3 G T 7: 140,848,383 W10L probably damaging Het
Olfr936 A C 9: 39,047,187 D77E probably damaging Het
Pcsk5 T C 19: 17,837,148 D2G possibly damaging Het
Pdpn G A 4: 143,274,038 R75C probably damaging Het
Pidd1 A T 7: 141,438,812 F842Y probably damaging Het
Sema3a A G 5: 13,516,223 Q158R probably benign Het
Setbp1 T A 18: 78,856,583 R1290W probably damaging Het
Slc20a1 G A 2: 129,208,404 G494D probably benign Het
Spag17 A G 3: 99,982,268 E151G possibly damaging Het
Stt3b A G 9: 115,257,499 F351L probably benign Het
Tas1r2 A G 4: 139,669,125 M592V probably benign Het
Tbcd A G 11: 121,497,083 T347A probably benign Het
Tmem109 C A 19: 10,874,369 R37L possibly damaging Het
Tmem67 G A 4: 12,045,871 S862L possibly damaging Het
Ttn T A 2: 76,951,513 D1017V probably damaging Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zfyve16 T C 13: 92,508,305 S1130G possibly damaging Het
Other mutations in Osmr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Osmr APN 15 6844445 nonsense probably null
IGL00335:Osmr APN 15 6837023 missense probably benign 0.00
IGL00497:Osmr APN 15 6847066 missense probably benign 0.26
IGL00510:Osmr APN 15 6823631 nonsense probably null
IGL00811:Osmr APN 15 6815666 missense probably benign 0.28
IGL00959:Osmr APN 15 6824605 missense probably benign 0.12
IGL01115:Osmr APN 15 6847201 splice site probably benign
IGL01307:Osmr APN 15 6844427 missense probably damaging 1.00
IGL01330:Osmr APN 15 6842028 missense probably damaging 1.00
IGL01633:Osmr APN 15 6824604 missense probably damaging 1.00
IGL01780:Osmr APN 15 6828663 missense probably benign 0.00
IGL02164:Osmr APN 15 6842048 missense probably damaging 0.99
IGL02207:Osmr APN 15 6847147 missense probably benign 0.07
IGL02338:Osmr APN 15 6837729 nonsense probably null
IGL02350:Osmr APN 15 6828663 missense probably benign 0.00
IGL02357:Osmr APN 15 6828663 missense probably benign 0.00
IGL02545:Osmr APN 15 6823579 missense probably damaging 0.98
IGL02619:Osmr APN 15 6841994 missense probably damaging 1.00
IGL02685:Osmr APN 15 6815573 missense probably benign 0.00
IGL02959:Osmr APN 15 6815897 missense possibly damaging 0.93
IGL03303:Osmr APN 15 6842808 missense probably benign 0.03
FR4548:Osmr UTSW 15 6837703 small insertion probably benign
FR4737:Osmr UTSW 15 6837706 nonsense probably null
R0149:Osmr UTSW 15 6841951 critical splice donor site probably null
R0361:Osmr UTSW 15 6841951 critical splice donor site probably null
R0492:Osmr UTSW 15 6824518 missense probably damaging 1.00
R0538:Osmr UTSW 15 6841938 splice site probably benign
R0585:Osmr UTSW 15 6837793 missense probably benign
R0980:Osmr UTSW 15 6852440 missense probably benign 0.00
R1922:Osmr UTSW 15 6844367 missense possibly damaging 0.67
R2067:Osmr UTSW 15 6815415 missense probably benign 0.00
R2136:Osmr UTSW 15 6852462 missense probably damaging 1.00
R2156:Osmr UTSW 15 6844410 missense probably benign 0.04
R3683:Osmr UTSW 15 6837053 missense possibly damaging 0.95
R3735:Osmr UTSW 15 6822080 missense probably damaging 1.00
R3736:Osmr UTSW 15 6822080 missense probably damaging 1.00
R4011:Osmr UTSW 15 6824533 missense probably benign 0.01
R4175:Osmr UTSW 15 6852546 missense probably damaging 1.00
R4555:Osmr UTSW 15 6815720 missense possibly damaging 0.73
R4581:Osmr UTSW 15 6842894 missense probably benign 0.00
R4751:Osmr UTSW 15 6842852 missense probably damaging 1.00
R4758:Osmr UTSW 15 6852555 missense probably benign 0.23
R4986:Osmr UTSW 15 6816580 critical splice donor site probably null
R4997:Osmr UTSW 15 6815639 missense probably benign 0.25
R5077:Osmr UTSW 15 6844393 nonsense probably null
R5093:Osmr UTSW 15 6821079 missense probably damaging 0.96
R5120:Osmr UTSW 15 6827275 missense probably benign 0.16
R5331:Osmr UTSW 15 6842881 missense probably damaging 1.00
R5812:Osmr UTSW 15 6837059 missense probably damaging 0.99
R5819:Osmr UTSW 15 6815787 missense probably benign 0.00
R5876:Osmr UTSW 15 6821047 missense probably benign 0.07
R5986:Osmr UTSW 15 6844453 missense probably benign 0.36
R6018:Osmr UTSW 15 6815795 missense probably damaging 1.00
R6164:Osmr UTSW 15 6860352 missense probably benign 0.00
R6217:Osmr UTSW 15 6823566 missense probably damaging 1.00
R6312:Osmr UTSW 15 6823638 missense probably damaging 1.00
R6349:Osmr UTSW 15 6821063 missense probably benign 0.00
R6898:Osmr UTSW 15 6815883 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCATCATGGAAGTAGCACAGTCGTTAAG -3'
(R):5'- TGTCCTTTCCTGCTCAGCTCAAATG -3'

Sequencing Primer
(F):5'- tgggaggcagaggcagg -3'
(R):5'- GATGTCATCGTGTCTTCTTAAAAACC -3'
Posted On2014-01-15