Incidental Mutation 'R1221:Gm4952'
ID100165
Institutional Source Beutler Lab
Gene Symbol Gm4952
Ensembl Gene ENSMUSG00000071633
Gene Namepredicted gene 4952
Synonyms
MMRRC Submission 039290-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.024) question?
Stock #R1221 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location12599974-12628251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12623695 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 93 (D93V)
Ref Sequence ENSEMBL: ENSMUSP00000090607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092931] [ENSMUST00000181868]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092931
AA Change: D93V

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090607
Gene: ENSMUSG00000071633
AA Change: D93V

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 206 2.6e-90 PFAM
Pfam:Gly_acyl_tr_C 207 295 2.7e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181868
AA Change: D93V

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000137934
Gene: ENSMUSG00000071633
AA Change: D93V

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 206 3.7e-112 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,221 V255E probably benign Het
Aak1 T C 6: 86,965,478 S668P unknown Het
Anks1 A G 17: 28,050,642 Q770R possibly damaging Het
Apc2 G A 10: 80,306,380 V378I probably damaging Het
Apeh A G 9: 108,092,609 V184A probably benign Het
AU018091 A G 7: 3,158,877 F404S probably damaging Het
Bap1 T C 14: 31,257,651 L537P probably damaging Het
Bhlha15 A G 5: 144,191,523 Y151C probably damaging Het
Bmp8b A T 4: 123,114,711 T157S probably damaging Het
Btbd1 G T 7: 81,818,257 H172N possibly damaging Het
C1rl A G 6: 124,493,981 R83G probably benign Het
Cep104 A G 4: 153,988,445 T387A probably benign Het
Cfi A T 3: 129,872,969 Q447L probably damaging Het
Coq6 A G 12: 84,371,527 E295G possibly damaging Het
Dclre1a T C 19: 56,531,268 T978A possibly damaging Het
Dlc1 T C 8: 36,584,831 D582G probably benign Het
Dlgap2 A G 8: 14,726,952 T65A probably benign Het
Dock5 G A 14: 67,759,161 S1711L probably benign Het
Drc3 A C 11: 60,384,226 I338L probably benign Het
Dsc1 A T 18: 20,114,542 C5* probably null Het
F5 A G 1: 164,161,799 Y90C probably damaging Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Gm136 G T 4: 34,744,127 A239E possibly damaging Het
Gramd1c T C 16: 43,989,864 T454A possibly damaging Het
Gstm6 A G 3: 107,941,102 I58T probably damaging Het
Kdm3b C T 18: 34,808,245 S263L possibly damaging Het
Kdm5b G C 1: 134,599,091 S317T probably damaging Het
Myo15b A G 11: 115,886,720 R71G possibly damaging Het
Nlrp1b G A 11: 71,181,464 P518S probably benign Het
Nme5 A T 18: 34,571,522 I90N probably damaging Het
Nrxn1 T A 17: 90,643,294 T478S probably damaging Het
Odf3 G T 7: 140,848,383 W10L probably damaging Het
Olfr936 A C 9: 39,047,187 D77E probably damaging Het
Osmr G A 15: 6,823,561 Q617* probably null Het
Pcsk5 T C 19: 17,837,148 D2G possibly damaging Het
Pdpn G A 4: 143,274,038 R75C probably damaging Het
Pidd1 A T 7: 141,438,812 F842Y probably damaging Het
Sema3a A G 5: 13,516,223 Q158R probably benign Het
Setbp1 T A 18: 78,856,583 R1290W probably damaging Het
Slc20a1 G A 2: 129,208,404 G494D probably benign Het
Spag17 A G 3: 99,982,268 E151G possibly damaging Het
Stt3b A G 9: 115,257,499 F351L probably benign Het
Tas1r2 A G 4: 139,669,125 M592V probably benign Het
Tbcd A G 11: 121,497,083 T347A probably benign Het
Tmem109 C A 19: 10,874,369 R37L possibly damaging Het
Tmem67 G A 4: 12,045,871 S862L possibly damaging Het
Ttn T A 2: 76,951,513 D1017V probably damaging Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zfyve16 T C 13: 92,508,305 S1130G possibly damaging Het
Other mutations in Gm4952
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Gm4952 APN 19 12618408 missense probably damaging 1.00
IGL00990:Gm4952 APN 19 12623623 missense probably damaging 1.00
IGL01542:Gm4952 APN 19 12618407 missense possibly damaging 0.88
IGL01714:Gm4952 APN 19 12624711 missense probably benign 0.16
IGL02339:Gm4952 APN 19 12626911 missense probably damaging 0.98
IGL03068:Gm4952 APN 19 12623704 missense probably damaging 0.99
IGL03100:Gm4952 APN 19 12624719 critical splice donor site probably null
IGL03274:Gm4952 APN 19 12623596 splice site probably benign
IGL03295:Gm4952 APN 19 12618327 missense probably benign 0.39
R0604:Gm4952 UTSW 19 12624672 missense probably benign 0.07
R1513:Gm4952 UTSW 19 12624675 missense probably damaging 0.99
R1514:Gm4952 UTSW 19 12626914 missense probably damaging 1.00
R1804:Gm4952 UTSW 19 12618420 missense probably damaging 0.98
R1928:Gm4952 UTSW 19 12623609 missense probably damaging 0.99
R2447:Gm4952 UTSW 19 12618406 missense possibly damaging 0.70
R4930:Gm4952 UTSW 19 12627012 missense probably benign 0.00
R5360:Gm4952 UTSW 19 12623629 missense probably benign 0.08
R5704:Gm4952 UTSW 19 12626911 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGCTAACGGCTGCTGAGAGAC -3'
(R):5'- AAACAGGTCAGAGGTCAAGCCCTGTC -3'

Sequencing Primer
(F):5'- ggaggaattggagtgacagag -3'
(R):5'- CAGACCAAGGTATGTTCATTAGGTTG -3'
Posted On2014-01-15