Incidental Mutation 'R1203:Csrp3'
ID100257
Institutional Source Beutler Lab
Gene Symbol Csrp3
Ensembl Gene ENSMUSG00000030470
Gene Namecysteine and glycine-rich protein 3
SynonymsMLP, muscle LIM protein, CRP3
MMRRC Submission 039273-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.613) question?
Stock #R1203 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location48830398-48848033 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) C to A at 48839530 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 1 (M1I)
Ref Sequence ENSEMBL: ENSMUSP00000129378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032658] [ENSMUST00000167786] [ENSMUST00000208050]
Predicted Effect probably null
Transcript: ENSMUST00000032658
AA Change: M1I

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032658
Gene: ENSMUSG00000030470
AA Change: M1I

DomainStartEndE-ValueType
LIM 9 61 5.87e-12 SMART
LIM 119 171 3.96e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167786
AA Change: M1I

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129378
Gene: ENSMUSG00000030470
AA Change: M1I

DomainStartEndE-ValueType
LIM 9 61 5.87e-12 SMART
LIM 119 171 3.96e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000208050
AA Change: M1I

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208146
Meta Mutation Damage Score 0.44 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.4%
  • 10x: 95.6%
  • 20x: 89.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CSRP family of LIM domain proteins, which may be involved in regulatory processes important for development and cellular differentiation. The LIM/double zinc-finger motif found in this protein is found in a group of proteins with critical functions in gene regulation, cell growth, and somatic differentiation. Mutations in this gene are thought to cause heritable forms of hypertrophic cardiomyopathy (HCM) and dilated cardiomyopathy (DCM) in humans. Alternatively spliced transcript variants with different 5' UTR, but encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit dilated cardiomyopathy characterized by disrupted cardiomyocyte organization that results in premature death, left ventricle dilation, hypertrophy, decreased contractility, and fibrosis. Some homozygotes die postnataly due to heart failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,518,594 R78S probably damaging Het
Aadacl3 T C 4: 144,463,570 T54A probably benign Het
Adcy8 A G 15: 64,746,931 I791T probably damaging Het
Aldh1b1 A G 4: 45,803,359 D299G probably damaging Het
Aoah A G 13: 20,816,594 E66G probably damaging Het
Atl2 G T 17: 79,852,905 H418N probably damaging Het
Atp6v1d A G 12: 78,861,440 I7T possibly damaging Het
Calhm3 C T 19: 47,155,400 V155M probably damaging Het
Carmil1 A T 13: 24,099,006 I105K probably damaging Het
Dnah10 T A 5: 124,760,014 probably null Het
Dnah11 T C 12: 117,933,812 N3561S possibly damaging Het
Dzip3 A T 16: 48,951,817 D496E probably damaging Het
Eif2ak1 T C 5: 143,883,979 V246A probably benign Het
Fam171b T A 2: 83,812,969 V74E probably benign Het
Gm14137 C T 2: 119,175,124 R55W probably damaging Het
Gm4950 T C 18: 51,865,758 I42V probably benign Het
Gpr35 T C 1: 92,983,148 V194A probably damaging Het
Kdm5d C T Y: 941,011 S1132F probably damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Ncln A G 10: 81,496,193 V24A possibly damaging Het
Nphp4 A G 4: 152,488,832 K76E probably damaging Het
Nsf CAATAATAATAATAATA CAATAATAATAATAATAATA 11: 103,926,126 probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr649 A T 7: 104,189,853 L118* probably null Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pcbd2 G A 13: 55,733,068 probably null Het
Rapgef6 T A 11: 54,691,699 V1479D probably benign Het
Rnf43 T C 11: 87,727,475 probably benign Het
Robo3 A G 9: 37,418,682 W1113R probably damaging Het
Sall1 A T 8: 89,031,934 V514E probably damaging Het
Sgpp1 A G 12: 75,716,282 I375T probably benign Het
Strc T C 2: 121,372,123 N1187S possibly damaging Het
Tbc1d17 G A 7: 44,843,471 R363W probably damaging Het
Tbcd A G 11: 121,475,625 Q242R probably benign Het
Tbcel A C 9: 42,451,651 V50G probably damaging Het
Tead3 C T 17: 28,341,562 A23T probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem136 A G 9: 43,111,480 V193A probably benign Het
Tmem241 G T 18: 12,083,978 probably benign Het
Tmtc3 G T 10: 100,476,744 T79K probably damaging Het
Utrn A G 10: 12,486,537 V241A probably damaging Het
Vps8 A T 16: 21,511,557 I729F probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Other mutations in Csrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Csrp3 APN 7 48830692 missense probably benign 0.24
R4778:Csrp3 UTSW 7 48832563 missense probably damaging 0.98
R5577:Csrp3 UTSW 7 48839477 missense possibly damaging 0.90
R6010:Csrp3 UTSW 7 48835465 critical splice donor site probably null
R6472:Csrp3 UTSW 7 48835608 missense possibly damaging 0.93
R7214:Csrp3 UTSW 7 48830637 missense probably benign
R7309:Csrp3 UTSW 7 48835569 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGTCATGCTCCTACATGCTGC -3'
(R):5'- GCTAAGCCCACTTCCGATGAGATAC -3'

Sequencing Primer
(F):5'- GTAGGACTACATGAGAACTCTGAACC -3'
(R):5'- AAGACTAGCAGTCTATTCCTTCCAG -3'
Posted On2014-01-15