Incidental Mutation 'R1203:Csrp3'
ID 100257
Institutional Source Beutler Lab
Gene Symbol Csrp3
Ensembl Gene ENSMUSG00000030470
Gene Name cysteine and glycine-rich protein 3
Synonyms MLP, muscle LIM protein, CRP3
MMRRC Submission 039273-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.646) question?
Stock # R1203 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 48480146-48497781 bp(-) (GRCm39)
Type of Mutation start codon destroyed
DNA Base Change (assembly) C to A at 48489278 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 1 (M1I)
Ref Sequence ENSEMBL: ENSMUSP00000129378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032658] [ENSMUST00000167786] [ENSMUST00000208050]
AlphaFold P50462
Predicted Effect probably null
Transcript: ENSMUST00000032658
AA Change: M1I

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032658
Gene: ENSMUSG00000030470
AA Change: M1I

DomainStartEndE-ValueType
LIM 9 61 5.87e-12 SMART
LIM 119 171 3.96e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167786
AA Change: M1I

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129378
Gene: ENSMUSG00000030470
AA Change: M1I

DomainStartEndE-ValueType
LIM 9 61 5.87e-12 SMART
LIM 119 171 3.96e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000208050
AA Change: M1I

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208146
Meta Mutation Damage Score 0.9701 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.4%
  • 10x: 95.6%
  • 20x: 89.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CSRP family of LIM domain proteins, which may be involved in regulatory processes important for development and cellular differentiation. The LIM/double zinc-finger motif found in this protein is found in a group of proteins with critical functions in gene regulation, cell growth, and somatic differentiation. Mutations in this gene are thought to cause heritable forms of hypertrophic cardiomyopathy (HCM) and dilated cardiomyopathy (DCM) in humans. Alternatively spliced transcript variants with different 5' UTR, but encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit dilated cardiomyopathy characterized by disrupted cardiomyocyte organization that results in premature death, left ventricle dilation, hypertrophy, decreased contractility, and fibrosis. Some homozygotes die postnataly due to heart failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,588,818 (GRCm39) R78S probably damaging Het
Aadacl3 T C 4: 144,190,140 (GRCm39) T54A probably benign Het
Adcy8 A G 15: 64,618,780 (GRCm39) I791T probably damaging Het
Aldh1b1 A G 4: 45,803,359 (GRCm39) D299G probably damaging Het
Aoah A G 13: 21,000,764 (GRCm39) E66G probably damaging Het
Atl2 G T 17: 80,160,334 (GRCm39) H418N probably damaging Het
Atp6v1d A G 12: 78,908,214 (GRCm39) I7T possibly damaging Het
Calhm3 C T 19: 47,143,839 (GRCm39) V155M probably damaging Het
Carmil1 A T 13: 24,282,989 (GRCm39) I105K probably damaging Het
Dnah10 T A 5: 124,837,078 (GRCm39) probably null Het
Dnah11 T C 12: 117,897,547 (GRCm39) N3561S possibly damaging Het
Dzip3 A T 16: 48,772,180 (GRCm39) D496E probably damaging Het
Eif2ak1 T C 5: 143,820,797 (GRCm39) V246A probably benign Het
Fam171b T A 2: 83,643,313 (GRCm39) V74E probably benign Het
Gm14137 C T 2: 119,005,605 (GRCm39) R55W probably damaging Het
Gm4950 T C 18: 51,998,830 (GRCm39) I42V probably benign Het
Gpr35 T C 1: 92,910,870 (GRCm39) V194A probably damaging Het
Kdm5d C T Y: 941,011 (GRCm39) S1132F probably damaging Het
Muc4 C A 16: 32,754,529 (GRCm38) H1468N probably benign Het
Ncln A G 10: 81,332,027 (GRCm39) V24A possibly damaging Het
Nphp4 A G 4: 152,573,289 (GRCm39) K76E probably damaging Het
Nsf CAATAATAATAATAATA CAATAATAATAATAATAATA 11: 103,816,952 (GRCm39) probably benign Het
Nup155 A T 15: 8,187,244 (GRCm39) H1391L probably damaging Het
Or52h2 A T 7: 103,839,060 (GRCm39) L118* probably null Het
Pabpc1l G T 2: 163,879,091 (GRCm39) V313F possibly damaging Het
Pcbd2 G A 13: 55,880,881 (GRCm39) probably null Het
Rapgef6 T A 11: 54,582,525 (GRCm39) V1479D probably benign Het
Rnf43 T C 11: 87,618,301 (GRCm39) probably benign Het
Robo3 A G 9: 37,329,978 (GRCm39) W1113R probably damaging Het
Sall1 A T 8: 89,758,562 (GRCm39) V514E probably damaging Het
Sgpp1 A G 12: 75,763,056 (GRCm39) I375T probably benign Het
Strc T C 2: 121,202,604 (GRCm39) N1187S possibly damaging Het
Tbc1d17 G A 7: 44,492,895 (GRCm39) R363W probably damaging Het
Tbcd A G 11: 121,366,451 (GRCm39) Q242R probably benign Het
Tbcel A C 9: 42,362,947 (GRCm39) V50G probably damaging Het
Tead3 C T 17: 28,560,536 (GRCm39) A23T probably benign Het
Tedc2 T A 17: 24,435,291 (GRCm39) E366V probably damaging Het
Tedc2 C A 17: 24,435,292 (GRCm39) E366* probably null Het
Tlcd5 A G 9: 43,022,775 (GRCm39) V193A probably benign Het
Tmem241 G T 18: 12,217,035 (GRCm39) probably benign Het
Tmtc3 G T 10: 100,312,606 (GRCm39) T79K probably damaging Het
Utrn A G 10: 12,362,281 (GRCm39) V241A probably damaging Het
Vps8 A T 16: 21,330,307 (GRCm39) I729F probably damaging Het
Zfp407 C T 18: 84,577,898 (GRCm39) A1072T probably benign Het
Other mutations in Csrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Csrp3 APN 7 48,480,440 (GRCm39) missense probably benign 0.24
R4778:Csrp3 UTSW 7 48,482,311 (GRCm39) missense probably damaging 0.98
R5577:Csrp3 UTSW 7 48,489,225 (GRCm39) missense possibly damaging 0.90
R6010:Csrp3 UTSW 7 48,485,213 (GRCm39) critical splice donor site probably null
R6472:Csrp3 UTSW 7 48,485,356 (GRCm39) missense possibly damaging 0.93
R7214:Csrp3 UTSW 7 48,480,385 (GRCm39) missense probably benign
R7309:Csrp3 UTSW 7 48,485,317 (GRCm39) missense probably benign
R7803:Csrp3 UTSW 7 48,483,545 (GRCm39) missense probably benign 0.30
R9395:Csrp3 UTSW 7 48,489,231 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCATGCTCCTACATGCTGC -3'
(R):5'- GCTAAGCCCACTTCCGATGAGATAC -3'

Sequencing Primer
(F):5'- GTAGGACTACATGAGAACTCTGAACC -3'
(R):5'- AAGACTAGCAGTCTATTCCTTCCAG -3'
Posted On 2014-01-15