Incidental Mutation 'R1203:Tbcel'
ID100264
Institutional Source Beutler Lab
Gene Symbol Tbcel
Ensembl Gene ENSMUSG00000037287
Gene Nametubulin folding cofactor E-like
SynonymsE130107N23Rik, Lrrc35
MMRRC Submission 039273-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R1203 (G1)
Quality Score123
Status Validated
Chromosome9
Chromosomal Location42412316-42507809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 42451651 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 50 (V50G)
Ref Sequence ENSEMBL: ENSMUSP00000065125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066148] [ENSMUST00000066179] [ENSMUST00000125995] [ENSMUST00000128959] [ENSMUST00000134374] [ENSMUST00000138506]
Predicted Effect probably damaging
Transcript: ENSMUST00000066148
AA Change: V32G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067882
Gene: ENSMUSG00000037287
AA Change: V32G

DomainStartEndE-ValueType
internal_repeat_1 73 103 7.53e-6 PROSPERO
low complexity region 105 115 N/A INTRINSIC
low complexity region 147 160 N/A INTRINSIC
internal_repeat_1 173 203 7.53e-6 PROSPERO
Pfam:Ubiquitin_2 344 424 1.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000066179
AA Change: V50G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000065125
Gene: ENSMUSG00000037287
AA Change: V50G

DomainStartEndE-ValueType
internal_repeat_1 91 121 9.76e-6 PROSPERO
low complexity region 123 133 N/A INTRINSIC
low complexity region 165 178 N/A INTRINSIC
internal_repeat_1 191 221 9.76e-6 PROSPERO
Pfam:Ubiquitin_2 362 442 1.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125995
AA Change: V32G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114721
Gene: ENSMUSG00000037287
AA Change: V32G

DomainStartEndE-ValueType
internal_repeat_1 73 103 7.53e-6 PROSPERO
low complexity region 105 115 N/A INTRINSIC
low complexity region 147 160 N/A INTRINSIC
internal_repeat_1 173 203 7.53e-6 PROSPERO
Pfam:Ubiquitin_2 344 424 1.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128959
AA Change: V32G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121164
Gene: ENSMUSG00000037287
AA Change: V32G

DomainStartEndE-ValueType
internal_repeat_1 73 103 7.53e-6 PROSPERO
low complexity region 105 115 N/A INTRINSIC
low complexity region 147 160 N/A INTRINSIC
internal_repeat_1 173 203 7.53e-6 PROSPERO
Pfam:Ubiquitin_2 344 424 1.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134374
AA Change: V32G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000138506
AA Change: V32G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116616
Gene: ENSMUSG00000037287
AA Change: V32G

DomainStartEndE-ValueType
internal_repeat_1 73 103 7.53e-6 PROSPERO
low complexity region 105 115 N/A INTRINSIC
low complexity region 147 160 N/A INTRINSIC
internal_repeat_1 173 203 7.53e-6 PROSPERO
Pfam:Ubiquitin_2 344 424 1.1e-8 PFAM
Meta Mutation Damage Score 0.296 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.4%
  • 10x: 95.6%
  • 20x: 89.3%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,518,594 R78S probably damaging Het
Aadacl3 T C 4: 144,463,570 T54A probably benign Het
Adcy8 A G 15: 64,746,931 I791T probably damaging Het
Aldh1b1 A G 4: 45,803,359 D299G probably damaging Het
Aoah A G 13: 20,816,594 E66G probably damaging Het
Atl2 G T 17: 79,852,905 H418N probably damaging Het
Atp6v1d A G 12: 78,861,440 I7T possibly damaging Het
Calhm3 C T 19: 47,155,400 V155M probably damaging Het
Carmil1 A T 13: 24,099,006 I105K probably damaging Het
Csrp3 C A 7: 48,839,530 M1I probably null Het
Dnah10 T A 5: 124,760,014 probably null Het
Dnah11 T C 12: 117,933,812 N3561S possibly damaging Het
Dzip3 A T 16: 48,951,817 D496E probably damaging Het
Eif2ak1 T C 5: 143,883,979 V246A probably benign Het
Fam171b T A 2: 83,812,969 V74E probably benign Het
Gm14137 C T 2: 119,175,124 R55W probably damaging Het
Gm4950 T C 18: 51,865,758 I42V probably benign Het
Gpr35 T C 1: 92,983,148 V194A probably damaging Het
Kdm5d C T Y: 941,011 S1132F probably damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Ncln A G 10: 81,496,193 V24A possibly damaging Het
Nphp4 A G 4: 152,488,832 K76E probably damaging Het
Nsf CAATAATAATAATAATA CAATAATAATAATAATAATA 11: 103,926,126 probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr649 A T 7: 104,189,853 L118* probably null Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pcbd2 G A 13: 55,733,068 probably null Het
Rapgef6 T A 11: 54,691,699 V1479D probably benign Het
Rnf43 T C 11: 87,727,475 probably benign Het
Robo3 A G 9: 37,418,682 W1113R probably damaging Het
Sall1 A T 8: 89,031,934 V514E probably damaging Het
Sgpp1 A G 12: 75,716,282 I375T probably benign Het
Strc T C 2: 121,372,123 N1187S possibly damaging Het
Tbc1d17 G A 7: 44,843,471 R363W probably damaging Het
Tbcd A G 11: 121,475,625 Q242R probably benign Het
Tead3 C T 17: 28,341,562 A23T probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem136 A G 9: 43,111,480 V193A probably benign Het
Tmem241 G T 18: 12,083,978 probably benign Het
Tmtc3 G T 10: 100,476,744 T79K probably damaging Het
Utrn A G 10: 12,486,537 V241A probably damaging Het
Vps8 A T 16: 21,511,557 I729F probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Other mutations in Tbcel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Tbcel APN 9 42443037 missense probably benign 0.03
IGL01432:Tbcel APN 9 42444521 missense possibly damaging 0.79
IGL02223:Tbcel APN 9 42451718 missense probably benign 0.14
IGL03336:Tbcel APN 9 42439131 missense probably benign 0.17
R0346:Tbcel UTSW 9 42437243 splice site probably benign
R0415:Tbcel UTSW 9 42444500 missense probably benign 0.43
R0849:Tbcel UTSW 9 42437157 missense probably damaging 1.00
R1370:Tbcel UTSW 9 42450062 missense probably damaging 1.00
R1617:Tbcel UTSW 9 42461293 intron probably benign
R1995:Tbcel UTSW 9 42451661 missense probably damaging 1.00
R3196:Tbcel UTSW 9 42415952 missense probably damaging 0.99
R3618:Tbcel UTSW 9 42461295 intron probably benign
R4681:Tbcel UTSW 9 42449972 missense probably damaging 1.00
R5008:Tbcel UTSW 9 42416123 missense probably damaging 1.00
R5497:Tbcel UTSW 9 42451745 start codon destroyed possibly damaging 0.59
R5838:Tbcel UTSW 9 42415872 missense probably damaging 0.98
R5976:Tbcel UTSW 9 42439203 missense possibly damaging 0.95
R6993:Tbcel UTSW 9 42416117 nonsense probably null
S24628:Tbcel UTSW 9 42444500 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- ATGCCTCCAGCCAATCTGGAAGAC -3'
(R):5'- GTTACACACTTCTCCAGTACCCAGC -3'

Sequencing Primer
(F):5'- TGGAAGACTCAGTTCTCCGAG -3'
(R):5'- CCTTCCTTGTGAATAAGAATTCGTTC -3'
Posted On2014-01-15