Incidental Mutation 'R1203:Tmem136'
ID100266
Institutional Source Beutler Lab
Gene Symbol Tmem136
Ensembl Gene ENSMUSG00000048503
Gene Nametransmembrane protein 136
SynonymsLOC235300
MMRRC Submission 039273-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1203 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location43108650-43116570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43111480 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 193 (V193A)
Ref Sequence ENSEMBL: ENSMUSP00000150692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061833] [ENSMUST00000213544] [ENSMUST00000216126]
Predicted Effect probably benign
Transcript: ENSMUST00000061833
AA Change: V193A

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000051435
Gene: ENSMUSG00000048503
AA Change: V193A

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
TLC 29 225 7.82e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213544
AA Change: V193A

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215898
Predicted Effect probably benign
Transcript: ENSMUST00000216126
AA Change: V175A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.4%
  • 10x: 95.6%
  • 20x: 89.3%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,518,594 R78S probably damaging Het
Aadacl3 T C 4: 144,463,570 T54A probably benign Het
Adcy8 A G 15: 64,746,931 I791T probably damaging Het
Aldh1b1 A G 4: 45,803,359 D299G probably damaging Het
Aoah A G 13: 20,816,594 E66G probably damaging Het
Atl2 G T 17: 79,852,905 H418N probably damaging Het
Atp6v1d A G 12: 78,861,440 I7T possibly damaging Het
Calhm3 C T 19: 47,155,400 V155M probably damaging Het
Carmil1 A T 13: 24,099,006 I105K probably damaging Het
Csrp3 C A 7: 48,839,530 M1I probably null Het
Dnah10 T A 5: 124,760,014 probably null Het
Dnah11 T C 12: 117,933,812 N3561S possibly damaging Het
Dzip3 A T 16: 48,951,817 D496E probably damaging Het
Eif2ak1 T C 5: 143,883,979 V246A probably benign Het
Fam171b T A 2: 83,812,969 V74E probably benign Het
Gm14137 C T 2: 119,175,124 R55W probably damaging Het
Gm4950 T C 18: 51,865,758 I42V probably benign Het
Gpr35 T C 1: 92,983,148 V194A probably damaging Het
Kdm5d C T Y: 941,011 S1132F probably damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Ncln A G 10: 81,496,193 V24A possibly damaging Het
Nphp4 A G 4: 152,488,832 K76E probably damaging Het
Nsf CAATAATAATAATAATA CAATAATAATAATAATAATA 11: 103,926,126 probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr649 A T 7: 104,189,853 L118* probably null Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pcbd2 G A 13: 55,733,068 probably null Het
Rapgef6 T A 11: 54,691,699 V1479D probably benign Het
Rnf43 T C 11: 87,727,475 probably benign Het
Robo3 A G 9: 37,418,682 W1113R probably damaging Het
Sall1 A T 8: 89,031,934 V514E probably damaging Het
Sgpp1 A G 12: 75,716,282 I375T probably benign Het
Strc T C 2: 121,372,123 N1187S possibly damaging Het
Tbc1d17 G A 7: 44,843,471 R363W probably damaging Het
Tbcd A G 11: 121,475,625 Q242R probably benign Het
Tbcel A C 9: 42,451,651 V50G probably damaging Het
Tead3 C T 17: 28,341,562 A23T probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem241 G T 18: 12,083,978 probably benign Het
Tmtc3 G T 10: 100,476,744 T79K probably damaging Het
Utrn A G 10: 12,486,537 V241A probably damaging Het
Vps8 A T 16: 21,511,557 I729F probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Other mutations in Tmem136
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00658:Tmem136 APN 9 43113491 missense probably benign
IGL02010:Tmem136 APN 9 43111564 missense probably damaging 1.00
IGL02649:Tmem136 APN 9 43111488 missense probably benign 0.00
R0363:Tmem136 UTSW 9 43111753 missense probably damaging 1.00
R0694:Tmem136 UTSW 9 43111626 nonsense probably null
R1534:Tmem136 UTSW 9 43111628 missense probably damaging 1.00
R3956:Tmem136 UTSW 9 43111513 missense probably damaging 0.99
R6044:Tmem136 UTSW 9 43113608 missense probably benign 0.33
R7437:Tmem136 UTSW 9 43111785 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAATCCAATCCACTGACTGGGGAC -3'
(R):5'- TGGCTCATCACACACTGAGCATC -3'

Sequencing Primer
(F):5'- ACAAGCCTTGACTAGTGTGTC -3'
(R):5'- ACAGAGGTCAATGCTGTACTC -3'
Posted On2014-01-15