Incidental Mutation 'R1203:Nsf'
ID100276
Institutional Source Beutler Lab
Gene Symbol Nsf
Ensembl Gene ENSMUSG00000034187
Gene NameN-ethylmaleimide sensitive fusion protein
SynonymsSKD2, N-ethylmaleimide sensitive factor
MMRRC Submission 039273-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1203 (G1)
Quality Score217
Status Validated
Chromosome11
Chromosomal Location103821782-103954056 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) CAATAATAATAATAATA to CAATAATAATAATAATAATA at 103926126 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103075] [ENSMUST00000133774] [ENSMUST00000149642]
Predicted Effect probably benign
Transcript: ENSMUST00000103075
SMART Domains Protein: ENSMUSP00000099364
Gene: ENSMUSG00000034187

DomainStartEndE-ValueType
CDC48_N 5 86 2.7e-16 SMART
CDC48_2 111 183 6.22e-7 SMART
AAA 252 399 3.65e-19 SMART
AAA 535 671 2.2e-13 SMART
low complexity region 674 683 N/A INTRINSIC
low complexity region 698 711 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107009
Predicted Effect probably benign
Transcript: ENSMUST00000133774
SMART Domains Protein: ENSMUSP00000133591
Gene: ENSMUSG00000034187

DomainStartEndE-ValueType
Pfam:CDC48_N 1 51 1.5e-10 PFAM
CDC48_2 76 148 6.22e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145126
Predicted Effect probably benign
Transcript: ENSMUST00000149642
SMART Domains Protein: ENSMUSP00000133603
Gene: ENSMUSG00000034187

DomainStartEndE-ValueType
CDC48_N 2 76 6.51e-10 SMART
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.4%
  • 10x: 95.6%
  • 20x: 89.3%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,518,594 R78S probably damaging Het
Aadacl3 T C 4: 144,463,570 T54A probably benign Het
Adcy8 A G 15: 64,746,931 I791T probably damaging Het
Aldh1b1 A G 4: 45,803,359 D299G probably damaging Het
Aoah A G 13: 20,816,594 E66G probably damaging Het
Atl2 G T 17: 79,852,905 H418N probably damaging Het
Atp6v1d A G 12: 78,861,440 I7T possibly damaging Het
Calhm3 C T 19: 47,155,400 V155M probably damaging Het
Carmil1 A T 13: 24,099,006 I105K probably damaging Het
Csrp3 C A 7: 48,839,530 M1I probably null Het
Dnah10 T A 5: 124,760,014 probably null Het
Dnah11 T C 12: 117,933,812 N3561S possibly damaging Het
Dzip3 A T 16: 48,951,817 D496E probably damaging Het
Eif2ak1 T C 5: 143,883,979 V246A probably benign Het
Fam171b T A 2: 83,812,969 V74E probably benign Het
Gm14137 C T 2: 119,175,124 R55W probably damaging Het
Gm4950 T C 18: 51,865,758 I42V probably benign Het
Gpr35 T C 1: 92,983,148 V194A probably damaging Het
Kdm5d C T Y: 941,011 S1132F probably damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Ncln A G 10: 81,496,193 V24A possibly damaging Het
Nphp4 A G 4: 152,488,832 K76E probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr649 A T 7: 104,189,853 L118* probably null Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pcbd2 G A 13: 55,733,068 probably null Het
Rapgef6 T A 11: 54,691,699 V1479D probably benign Het
Rnf43 T C 11: 87,727,475 probably benign Het
Robo3 A G 9: 37,418,682 W1113R probably damaging Het
Sall1 A T 8: 89,031,934 V514E probably damaging Het
Sgpp1 A G 12: 75,716,282 I375T probably benign Het
Strc T C 2: 121,372,123 N1187S possibly damaging Het
Tbc1d17 G A 7: 44,843,471 R363W probably damaging Het
Tbcd A G 11: 121,475,625 Q242R probably benign Het
Tbcel A C 9: 42,451,651 V50G probably damaging Het
Tead3 C T 17: 28,341,562 A23T probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmem136 A G 9: 43,111,480 V193A probably benign Het
Tmem241 G T 18: 12,083,978 probably benign Het
Tmtc3 G T 10: 100,476,744 T79K probably damaging Het
Utrn A G 10: 12,486,537 V241A probably damaging Het
Vps8 A T 16: 21,511,557 I729F probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Other mutations in Nsf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Nsf APN 11 103861885 splice site probably benign
IGL01377:Nsf APN 11 103872647 missense probably damaging 0.97
IGL01994:Nsf APN 11 103928782 missense probably damaging 0.98
IGL02141:Nsf APN 11 103828525 missense probably benign 0.02
IGL02663:Nsf APN 11 103930815 missense probably benign 0.04
IGL02871:Nsf APN 11 103862056 splice site probably benign
uhaul UTSW 11 103930752 missense possibly damaging 0.59
R0180:Nsf UTSW 11 103930780 missense probably damaging 1.00
R0880:Nsf UTSW 11 103913372 missense possibly damaging 0.72
R1146:Nsf UTSW 11 103828538 missense probably damaging 1.00
R1146:Nsf UTSW 11 103828538 missense probably damaging 1.00
R1873:Nsf UTSW 11 103859017 missense probably damaging 1.00
R1951:Nsf UTSW 11 103882876 nonsense probably null
R2163:Nsf UTSW 11 103863333 missense possibly damaging 0.64
R2193:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2194:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2287:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2289:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2343:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2345:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2346:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2347:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2350:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2405:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2406:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2407:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2408:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2409:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2411:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2435:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2924:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2925:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2987:Nsf UTSW 11 103859043 splice site probably null
R3177:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3277:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3741:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3742:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3845:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R4278:Nsf UTSW 11 103930806 missense probably damaging 0.96
R4717:Nsf UTSW 11 103823769 missense probably damaging 1.00
R4775:Nsf UTSW 11 103872593 missense possibly damaging 0.93
R4915:Nsf UTSW 11 103910359 unclassified probably benign
R4918:Nsf UTSW 11 103910359 unclassified probably benign
R5090:Nsf UTSW 11 103910578 missense probably benign 0.00
R5126:Nsf UTSW 11 103882792 nonsense probably null
R5411:Nsf UTSW 11 103882811 missense probably damaging 1.00
R5560:Nsf UTSW 11 103863255 missense possibly damaging 0.47
R6344:Nsf UTSW 11 103861904 missense probably damaging 1.00
R6596:Nsf UTSW 11 103910457 missense probably damaging 0.98
R7155:Nsf UTSW 11 103828530 nonsense probably null
R7272:Nsf UTSW 11 103827238 missense probably damaging 1.00
X0066:Nsf UTSW 11 103823740 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGGATCTGAATTCCAGCTCCAGC -3'
(R):5'- TGCAGTCTGCAAAGACCCTGAC -3'

Sequencing Primer
(F):5'- GCTGCCAGGTAAAATCTGATG -3'
(R):5'- CGAAAATGGGCTGGACTTTC -3'
Posted On2014-01-15