Mutagenetix > Incidental Mutation

Incidental Mutation 'R1204:Knl1'

100318

Institutional Source

Beutler Lab

Gene Symbol

Knl1

Ensembl Gene

ENSMUSG00000027326

Gene Name

kinetochore scaffold 1

Synonyms

Casc5, 2310043D08Rik, 5730505K17Rik

MMRRC Submission

039274-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1204 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118877600-118935982 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118901670 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1124 (I1124V)

Ref Sequence

ENSEMBL: ENSMUSP00000097140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028799] [ENSMUST00000028802] [ENSMUST00000099542] [ENSMUST00000152380]

AlphaFold

Q66JQ7

Predicted Effect

probably benign
Transcript: ENSMUST00000028799
AA Change: I1124V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000028799
Gene: ENSMUSG00000027326
AA Change: I1124V

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
PDB:4A1G\|H	126	175	1e-13	PDB
low complexity region	426	433	N/A	INTRINSIC
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000028802
AA Change: I1124V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: I1124V

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
internal_repeat_1	98	304	1.57e-6	PROSPERO
low complexity region	426	433	N/A	INTRINSIC
internal_repeat_1	610	824	1.57e-6	PROSPERO
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC
low complexity region	1621	1644	N/A	INTRINSIC
coiled coil region	1724	1755	N/A	INTRINSIC
low complexity region	1836	1850	N/A	INTRINSIC
low complexity region	1864	1878	N/A	INTRINSIC
PDB:4NF9\|B	1899	2119	1e-115	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000099542
AA Change: I1124V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: I1124V

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
internal_repeat_1	98	304	1.57e-6	PROSPERO
low complexity region	426	433	N/A	INTRINSIC
internal_repeat_1	610	824	1.57e-6	PROSPERO
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC
low complexity region	1621	1644	N/A	INTRINSIC
coiled coil region	1724	1755	N/A	INTRINSIC
low complexity region	1836	1850	N/A	INTRINSIC
low complexity region	1864	1878	N/A	INTRINSIC
PDB:4NF9\|B	1899	2119	1e-115	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000152380

SMART Domains

Protein: ENSMUSP00000118646
Gene: ENSMUSG00000027326

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
PDB:4A1G\|H	126	175	3e-14	PDB
low complexity region	426	433	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	A	T	5: 114,328,214 (GRCm39)	I133F	probably damaging	Het
Acyp1	A	T	12: 85,326,866 (GRCm39)		probably null	Het
Ermap	T	C	4: 119,046,064 (GRCm39)	K22R	possibly damaging	Het
Glce	T	C	9: 61,977,849 (GRCm39)	T12A	probably damaging	Het
Hao1	G	A	2: 134,364,947 (GRCm39)	R227*	probably null	Het
Hectd4	A	G	5: 121,488,548 (GRCm39)	D3613G	possibly damaging	Het
Hspa2	A	G	12: 76,451,641 (GRCm39)	M112V	probably benign	Het
Lrch3	T	C	16: 32,829,584 (GRCm39)	I738T	probably damaging	Het
Mgrn1	T	G	16: 4,725,273 (GRCm39)	F44V	probably damaging	Het
Or1af1	A	G	2: 37,109,651 (GRCm39)	Q50R	probably benign	Het
Otog	G	A	7: 45,909,335 (GRCm39)	V602M	probably benign	Het
Pik3r5	T	G	11: 68,385,050 (GRCm39)	L652V	probably benign	Het
Pkdrej	G	A	15: 85,702,513 (GRCm39)	T1141M	probably damaging	Het
Sema3a	T	C	5: 13,573,142 (GRCm39)		probably benign	Het
Syt3	A	T	7: 44,042,091 (GRCm39)	I317F	probably damaging	Het
Tmem214	C	T	5: 31,033,134 (GRCm39)	A509V	probably damaging	Het
Tmem25	T	C	9: 44,706,529 (GRCm39)	E284G	probably benign	Het
Trim9	T	C	12: 70,393,501 (GRCm39)	N148D	probably damaging	Het
Vmn2r107	A	G	17: 20,578,031 (GRCm39)	R447G	probably benign	Het
Zfp964	A	T	8: 70,116,668 (GRCm39)	I423L	probably benign	Het

Other mutations in Knl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Knl1	APN	2	118,894,564 (GRCm39)	missense	probably damaging	0.96
IGL00582:Knl1	APN	2	118,932,980 (GRCm39)	missense	probably benign	0.19
IGL00666:Knl1	APN	2	118,900,945 (GRCm39)	missense	probably damaging	0.96
IGL01062:Knl1	APN	2	118,907,461 (GRCm39)	missense	probably benign	0.33
IGL01395:Knl1	APN	2	118,902,047 (GRCm39)	missense	probably damaging	0.96
IGL01604:Knl1	APN	2	118,900,482 (GRCm39)	missense	probably damaging	1.00
IGL01996:Knl1	APN	2	118,934,542 (GRCm39)	missense	probably damaging	1.00
IGL02086:Knl1	APN	2	118,931,255 (GRCm39)	missense	probably benign	0.40
IGL02105:Knl1	APN	2	118,902,289 (GRCm39)	missense	probably benign
IGL02106:Knl1	APN	2	118,902,489 (GRCm39)	missense	possibly damaging	0.89
IGL02201:Knl1	APN	2	118,899,633 (GRCm39)	missense	probably benign	0.01
IGL02252:Knl1	APN	2	118,903,021 (GRCm39)	missense	probably damaging	1.00
IGL02414:Knl1	APN	2	118,900,804 (GRCm39)	missense	possibly damaging	0.83
IGL02655:Knl1	APN	2	118,901,473 (GRCm39)	missense	possibly damaging	0.62
IGL02682:Knl1	APN	2	118,908,450 (GRCm39)	missense	possibly damaging	0.86
IGL02710:Knl1	APN	2	118,901,411 (GRCm39)	missense	probably damaging	0.99
IGL02877:Knl1	APN	2	118,919,312 (GRCm39)	missense	probably benign	0.08
IGL03100:Knl1	APN	2	118,931,251 (GRCm39)	missense	probably damaging	0.99
IGL03210:Knl1	APN	2	118,901,098 (GRCm39)	missense	probably benign	0.02
IGL03138:Knl1	UTSW	2	118,902,840 (GRCm39)	missense	probably damaging	0.96
R0023:Knl1	UTSW	2	118,933,030 (GRCm39)	missense	possibly damaging	0.73
R0064:Knl1	UTSW	2	118,906,724 (GRCm39)	missense	probably benign	0.00
R0064:Knl1	UTSW	2	118,906,724 (GRCm39)	missense	probably benign	0.00
R0078:Knl1	UTSW	2	118,900,373 (GRCm39)	missense	probably benign	0.16
R0178:Knl1	UTSW	2	118,888,886 (GRCm39)	splice site	probably benign
R0295:Knl1	UTSW	2	118,919,320 (GRCm39)	missense	probably damaging	1.00
R0433:Knl1	UTSW	2	118,934,542 (GRCm39)	missense	probably damaging	0.96
R0453:Knl1	UTSW	2	118,898,869 (GRCm39)	missense	probably damaging	1.00
R0569:Knl1	UTSW	2	118,927,916 (GRCm39)	missense	possibly damaging	0.95
R0827:Knl1	UTSW	2	118,919,382 (GRCm39)	splice site	probably benign
R0920:Knl1	UTSW	2	118,900,309 (GRCm39)	missense	probably benign	0.00
R1120:Knl1	UTSW	2	118,892,856 (GRCm39)	missense	probably damaging	0.99
R1155:Knl1	UTSW	2	118,901,635 (GRCm39)	missense	possibly damaging	0.90
R1241:Knl1	UTSW	2	118,903,054 (GRCm39)	missense	probably benign	0.03
R1387:Knl1	UTSW	2	118,901,211 (GRCm39)	missense	possibly damaging	0.93
R1448:Knl1	UTSW	2	118,898,788 (GRCm39)	missense	probably damaging	1.00
R1469:Knl1	UTSW	2	118,901,827 (GRCm39)	missense	possibly damaging	0.73
R1469:Knl1	UTSW	2	118,901,827 (GRCm39)	missense	possibly damaging	0.73
R1719:Knl1	UTSW	2	118,902,219 (GRCm39)	missense	probably benign	0.01
R1721:Knl1	UTSW	2	118,906,815 (GRCm39)	missense	probably damaging	1.00
R2128:Knl1	UTSW	2	118,902,300 (GRCm39)	missense	possibly damaging	0.79
R2170:Knl1	UTSW	2	118,918,075 (GRCm39)	critical splice donor site	probably null
R2227:Knl1	UTSW	2	118,902,481 (GRCm39)	missense	probably damaging	0.97
R2246:Knl1	UTSW	2	118,902,708 (GRCm39)	missense	probably damaging	1.00
R2275:Knl1	UTSW	2	118,902,762 (GRCm39)	missense	probably damaging	0.99
R2508:Knl1	UTSW	2	118,888,849 (GRCm39)	nonsense	probably null
R3115:Knl1	UTSW	2	118,900,872 (GRCm39)	missense	possibly damaging	0.53
R3122:Knl1	UTSW	2	118,899,425 (GRCm39)	missense	probably benign	0.32
R3431:Knl1	UTSW	2	118,892,843 (GRCm39)	missense	probably damaging	1.00
R3755:Knl1	UTSW	2	118,933,060 (GRCm39)	missense	probably damaging	1.00
R4461:Knl1	UTSW	2	118,890,080 (GRCm39)	missense	probably benign	0.00
R4600:Knl1	UTSW	2	118,901,025 (GRCm39)	missense	possibly damaging	0.90
R4713:Knl1	UTSW	2	118,899,618 (GRCm39)	nonsense	probably null
R4758:Knl1	UTSW	2	118,902,213 (GRCm39)	frame shift	probably null
R4762:Knl1	UTSW	2	118,902,417 (GRCm39)	missense	probably benign	0.01
R4869:Knl1	UTSW	2	118,902,832 (GRCm39)	missense	possibly damaging	0.73
R4870:Knl1	UTSW	2	118,911,994 (GRCm39)	missense	probably benign	0.22
R4935:Knl1	UTSW	2	118,899,438 (GRCm39)	missense	possibly damaging	0.50
R5167:Knl1	UTSW	2	118,900,512 (GRCm39)	missense	probably damaging	1.00
R5184:Knl1	UTSW	2	118,899,657 (GRCm39)	missense	probably damaging	1.00
R5293:Knl1	UTSW	2	118,900,176 (GRCm39)	missense	probably damaging	0.99
R5326:Knl1	UTSW	2	118,898,829 (GRCm39)	missense	possibly damaging	0.66
R5331:Knl1	UTSW	2	118,900,736 (GRCm39)	missense	possibly damaging	0.92
R5353:Knl1	UTSW	2	118,901,464 (GRCm39)	missense	probably benign	0.01
R5493:Knl1	UTSW	2	118,899,211 (GRCm39)	missense	probably damaging	0.98
R5542:Knl1	UTSW	2	118,898,829 (GRCm39)	missense	possibly damaging	0.66
R5632:Knl1	UTSW	2	118,900,833 (GRCm39)	missense	probably damaging	1.00
R5650:Knl1	UTSW	2	118,912,031 (GRCm39)	nonsense	probably null
R5854:Knl1	UTSW	2	118,900,884 (GRCm39)	missense	probably benign	0.02
R5979:Knl1	UTSW	2	118,899,841 (GRCm39)	missense	possibly damaging	0.83
R6086:Knl1	UTSW	2	118,924,549 (GRCm39)	missense	probably damaging	1.00
R6283:Knl1	UTSW	2	118,900,767 (GRCm39)	missense	probably damaging	1.00
R6285:Knl1	UTSW	2	118,902,422 (GRCm39)	missense	probably damaging	1.00
R6313:Knl1	UTSW	2	118,899,799 (GRCm39)	missense	probably damaging	1.00
R6419:Knl1	UTSW	2	118,899,484 (GRCm39)	missense	probably benign	0.02
R6608:Knl1	UTSW	2	118,917,093 (GRCm39)	missense	probably damaging	0.99
R6881:Knl1	UTSW	2	118,925,665 (GRCm39)	missense	possibly damaging	0.67
R7161:Knl1	UTSW	2	118,901,266 (GRCm39)	missense	possibly damaging	0.79
R7206:Knl1	UTSW	2	118,899,780 (GRCm39)	missense	probably benign	0.35
R7270:Knl1	UTSW	2	118,933,003 (GRCm39)	missense	possibly damaging	0.53
R7276:Knl1	UTSW	2	118,902,167 (GRCm39)	missense	probably damaging	0.98
R7358:Knl1	UTSW	2	118,901,040 (GRCm39)	missense	possibly damaging	0.92
R7402:Knl1	UTSW	2	118,925,707 (GRCm39)	nonsense	probably null
R7408:Knl1	UTSW	2	118,901,073 (GRCm39)	missense	possibly damaging	0.54
R7475:Knl1	UTSW	2	118,918,027 (GRCm39)	missense	probably damaging	1.00
R7516:Knl1	UTSW	2	118,901,179 (GRCm39)	missense	probably damaging	0.99
R7524:Knl1	UTSW	2	118,896,460 (GRCm39)	missense	probably damaging	1.00
R7559:Knl1	UTSW	2	118,924,487 (GRCm39)	missense	possibly damaging	0.84
R7607:Knl1	UTSW	2	118,925,614 (GRCm39)	missense	possibly damaging	0.93
R7745:Knl1	UTSW	2	118,902,037 (GRCm39)	missense	probably benign	0.13
R7847:Knl1	UTSW	2	118,901,457 (GRCm39)	missense	probably benign	0.02
R8423:Knl1	UTSW	2	118,900,513 (GRCm39)	missense	probably damaging	1.00
R8725:Knl1	UTSW	2	118,899,524 (GRCm39)	missense	probably benign	0.34
R8727:Knl1	UTSW	2	118,899,524 (GRCm39)	missense	probably benign	0.34
R8995:Knl1	UTSW	2	118,902,990 (GRCm39)	missense	probably benign	0.11
R9023:Knl1	UTSW	2	118,900,761 (GRCm39)	missense	probably benign	0.27
R9100:Knl1	UTSW	2	118,899,469 (GRCm39)	missense	probably benign	0.02
R9102:Knl1	UTSW	2	118,917,973 (GRCm39)	missense	probably benign	0.22
R9303:Knl1	UTSW	2	118,898,829 (GRCm39)	missense	possibly damaging	0.83
R9400:Knl1	UTSW	2	118,931,224 (GRCm39)	missense	probably damaging	0.98
R9426:Knl1	UTSW	2	118,899,979 (GRCm39)	missense	possibly damaging	0.81
R9583:Knl1	UTSW	2	118,887,782 (GRCm39)	missense	probably damaging	1.00
R9616:Knl1	UTSW	2	118,907,425 (GRCm39)	missense	probably damaging	1.00
R9616:Knl1	UTSW	2	118,899,994 (GRCm39)	missense	probably benign	0.02
R9671:Knl1	UTSW	2	118,901,089 (GRCm39)	missense	probably damaging	1.00
R9766:Knl1	UTSW	2	118,900,381 (GRCm39)	missense	probably damaging	1.00
R9782:Knl1	UTSW	2	118,899,910 (GRCm39)	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CTTTGAGTGGTTCTGAAGGTGATACCC -3'
(R):5'- TCCTTTGCCAGGTTAAGAGATACATGC -3'

Sequencing Primer
(F):5'- GGTTCTGAAGGTGATACCCATATTC -3'
(R):5'- GGATCTTCATCTTTAAGCAGCG -3'

Posted On

2014-01-15