Mutagenetix > Incidental Mutation

Incidental Mutation 'R1204:Pik3r5'

100348

Institutional Source

Beutler Lab

Gene Symbol

Pik3r5

Ensembl Gene

ENSMUSG00000020901

Gene Name

phosphoinositide-3-kinase regulatory subunit 5

Synonyms

p101, Foap2

MMRRC Submission

039274-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.121) question?

Stock #

R1204 (G1)

Quality Score

146

Status

Not validated

Chromosome

Chromosomal Location

68322951-68388675 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 68385050 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Valine at position 652 (L652V)

Ref Sequence

ENSEMBL: ENSMUSP00000021283 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021283]

AlphaFold

Q5SW28

Predicted Effect

probably benign
Transcript: ENSMUST00000021283
AA Change: L652V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000021283
Gene: ENSMUSG00000020901
AA Change: L652V

Domain	Start	End	E-Value	Type
Pfam:PI3K_1B_p101	6	871	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126876

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155887

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinases (PI3Ks) phosphorylate the inositol ring of phosphatidylinositol at the 3-prime position, and play important roles in cell growth, proliferation, differentiation, motility, survival and intracellular trafficking. The PI3Ks are divided into three classes: I, II and III, and only the class I PI3Ks are involved in oncogenesis. This gene encodes the 101 kD regulatory subunit of the class I PI3K gamma complex, which is a dimeric enzyme, consisting of a 110 kD catalytic subunit gamma and a regulatory subunit of either 55, 87 or 101 kD. This protein recruits the catalytic subunit from the cytosol to the plasma membrane through high-affinity interaction with G-beta-gamma proteins. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been found. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced neutrophil chemotaxis and chemokinesis in vitro and impaired neutrophil recruitment into the peritoneum in a model of thioglycollate-induced aseptic peritonitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	A	T	5: 114,328,214 (GRCm39)	I133F	probably damaging	Het
Acyp1	A	T	12: 85,326,866 (GRCm39)		probably null	Het
Ermap	T	C	4: 119,046,064 (GRCm39)	K22R	possibly damaging	Het
Glce	T	C	9: 61,977,849 (GRCm39)	T12A	probably damaging	Het
Hao1	G	A	2: 134,364,947 (GRCm39)	R227*	probably null	Het
Hectd4	A	G	5: 121,488,548 (GRCm39)	D3613G	possibly damaging	Het
Hspa2	A	G	12: 76,451,641 (GRCm39)	M112V	probably benign	Het
Knl1	A	G	2: 118,901,670 (GRCm39)	I1124V	probably benign	Het
Lrch3	T	C	16: 32,829,584 (GRCm39)	I738T	probably damaging	Het
Mgrn1	T	G	16: 4,725,273 (GRCm39)	F44V	probably damaging	Het
Or1af1	A	G	2: 37,109,651 (GRCm39)	Q50R	probably benign	Het
Otog	G	A	7: 45,909,335 (GRCm39)	V602M	probably benign	Het
Pkdrej	G	A	15: 85,702,513 (GRCm39)	T1141M	probably damaging	Het
Sema3a	T	C	5: 13,573,142 (GRCm39)		probably benign	Het
Syt3	A	T	7: 44,042,091 (GRCm39)	I317F	probably damaging	Het
Tmem214	C	T	5: 31,033,134 (GRCm39)	A509V	probably damaging	Het
Tmem25	T	C	9: 44,706,529 (GRCm39)	E284G	probably benign	Het
Trim9	T	C	12: 70,393,501 (GRCm39)	N148D	probably damaging	Het
Vmn2r107	A	G	17: 20,578,031 (GRCm39)	R447G	probably benign	Het
Zfp964	A	T	8: 70,116,668 (GRCm39)	I423L	probably benign	Het

Other mutations in Pik3r5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01345:Pik3r5	APN	11	68,387,020 (GRCm39)	missense	possibly damaging	0.68
IGL01400:Pik3r5	APN	11	68,385,373 (GRCm39)	missense	probably benign	0.01
IGL01597:Pik3r5	APN	11	68,386,827 (GRCm39)	missense	probably damaging	1.00
IGL01622:Pik3r5	APN	11	68,377,452 (GRCm39)	splice site	probably null
IGL01623:Pik3r5	APN	11	68,377,452 (GRCm39)	splice site	probably null
IGL01878:Pik3r5	APN	11	68,383,356 (GRCm39)	missense	probably benign	0.00
IGL01953:Pik3r5	APN	11	68,384,997 (GRCm39)	missense	probably benign	0.00
IGL02056:Pik3r5	APN	11	68,381,681 (GRCm39)	missense	possibly damaging	0.86
IGL02345:Pik3r5	APN	11	68,383,552 (GRCm39)	missense	probably benign	0.03
palmetto	UTSW	11	68,385,059 (GRCm39)	missense	probably damaging	1.00
Palmito	UTSW	11	68,382,826 (GRCm39)	missense	probably damaging	1.00
palms	UTSW	11	68,377,448 (GRCm39)	critical splice donor site	probably null
piranha	UTSW	11	68,377,407 (GRCm39)	missense	probably damaging	1.00
Serenoa_repens	UTSW	11	68,366,250 (GRCm39)	nonsense	probably null
IGL02799:Pik3r5	UTSW	11	68,386,773 (GRCm39)	missense	probably damaging	0.98
R0077:Pik3r5	UTSW	11	68,377,448 (GRCm39)	critical splice donor site	probably null
R0092:Pik3r5	UTSW	11	68,383,629 (GRCm39)	missense	probably benign
R0105:Pik3r5	UTSW	11	68,381,337 (GRCm39)	missense	probably damaging	0.99
R0118:Pik3r5	UTSW	11	68,381,306 (GRCm39)	missense	probably damaging	1.00
R1447:Pik3r5	UTSW	11	68,385,003 (GRCm39)	missense	probably benign	0.18
R1865:Pik3r5	UTSW	11	68,383,318 (GRCm39)	missense	probably damaging	1.00
R2034:Pik3r5	UTSW	11	68,384,403 (GRCm39)	missense	probably damaging	0.99
R2356:Pik3r5	UTSW	11	68,383,743 (GRCm39)	missense	probably damaging	1.00
R4588:Pik3r5	UTSW	11	68,384,087 (GRCm39)	intron	probably benign
R4716:Pik3r5	UTSW	11	68,386,030 (GRCm39)	missense	possibly damaging	0.48
R4960:Pik3r5	UTSW	11	68,384,464 (GRCm39)	missense	probably benign	0.19
R5217:Pik3r5	UTSW	11	68,382,790 (GRCm39)	missense	possibly damaging	0.67
R5518:Pik3r5	UTSW	11	68,368,294 (GRCm39)	missense	possibly damaging	0.86
R5528:Pik3r5	UTSW	11	68,386,803 (GRCm39)	missense	probably damaging	1.00
R5554:Pik3r5	UTSW	11	68,385,059 (GRCm39)	missense	probably damaging	1.00
R5693:Pik3r5	UTSW	11	68,385,077 (GRCm39)	missense	probably damaging	1.00
R5841:Pik3r5	UTSW	11	68,383,096 (GRCm39)	missense	probably damaging	1.00
R6025:Pik3r5	UTSW	11	68,383,144 (GRCm39)	missense	probably damaging	0.97
R6168:Pik3r5	UTSW	11	68,383,501 (GRCm39)	missense	probably benign
R6243:Pik3r5	UTSW	11	68,382,826 (GRCm39)	missense	probably damaging	1.00
R6322:Pik3r5	UTSW	11	68,383,567 (GRCm39)	missense	probably benign
R6420:Pik3r5	UTSW	11	68,366,250 (GRCm39)	nonsense	probably null
R6505:Pik3r5	UTSW	11	68,383,615 (GRCm39)	missense	probably benign	0.16
R6534:Pik3r5	UTSW	11	68,381,443 (GRCm39)	missense	possibly damaging	0.59
R6817:Pik3r5	UTSW	11	68,377,407 (GRCm39)	missense	probably damaging	1.00
R7246:Pik3r5	UTSW	11	68,383,769 (GRCm39)	missense	probably benign	0.01
R7459:Pik3r5	UTSW	11	68,383,416 (GRCm39)	missense	probably benign	0.03
R7527:Pik3r5	UTSW	11	68,367,177 (GRCm39)	missense	probably damaging	1.00
R7739:Pik3r5	UTSW	11	68,381,324 (GRCm39)	missense	probably damaging	1.00
R7817:Pik3r5	UTSW	11	68,384,483 (GRCm39)	missense	probably damaging	0.99
R7877:Pik3r5	UTSW	11	68,381,431 (GRCm39)	missense	probably damaging	1.00
R7885:Pik3r5	UTSW	11	68,383,528 (GRCm39)	missense	possibly damaging	0.57
R7960:Pik3r5	UTSW	11	68,386,796 (GRCm39)	missense	probably benign	0.22
R8816:Pik3r5	UTSW	11	68,385,060 (GRCm39)	missense	probably damaging	1.00
R8836:Pik3r5	UTSW	11	68,385,104 (GRCm39)	missense	probably benign	0.06
R9131:Pik3r5	UTSW	11	68,383,099 (GRCm39)	missense	possibly damaging	0.64
R9649:Pik3r5	UTSW	11	68,381,720 (GRCm39)	missense	probably benign	0.00
R9706:Pik3r5	UTSW	11	68,381,426 (GRCm39)	missense	probably benign	0.00
Z1177:Pik3r5	UTSW	11	68,383,722 (GRCm39)	missense	possibly damaging	0.67

Predicted Primers

PCR Primer
(F):5'- TGCCCAACACTGTGTCCAGACC -3'
(R):5'- CCCACCTGAAGCCTTGATAGCC -3'

Sequencing Primer
(F):5'- AGACCCGGTCTCACGTTC -3'
(R):5'- AAGCCTTGATAGCCCGAGTG -3'

Posted On

2014-01-15