Incidental Mutation 'R1204:Vmn2r107'
ID100362
Institutional Source Beutler Lab
Gene Symbol Vmn2r107
Ensembl Gene ENSMUSG00000056910
Gene Namevomeronasal 2, receptor 107
SynonymsV2r6
MMRRC Submission 039274-MU
Accession Numbers

Genbank: NM_001104569; MGI: 1316664

Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R1204 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location20345425-20375772 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20357769 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 447 (R447G)
Ref Sequence ENSEMBL: ENSMUSP00000048706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042090]
Predicted Effect probably benign
Transcript: ENSMUST00000042090
AA Change: R447G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048706
Gene: ENSMUSG00000056910
AA Change: R447G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 466 3.6e-40 PFAM
Pfam:NCD3G 509 562 5.1e-21 PFAM
Pfam:7tm_3 593 830 8e-51 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,190,153 I133F probably damaging Het
Acyp1 A T 12: 85,280,092 probably null Het
Ermap T C 4: 119,188,867 K22R possibly damaging Het
Glce T C 9: 62,070,567 T12A probably damaging Het
Hao1 G A 2: 134,523,027 R227* probably null Het
Hectd4 A G 5: 121,350,485 D3613G possibly damaging Het
Hspa2 A G 12: 76,404,867 M112V probably benign Het
Knl1 A G 2: 119,071,189 I1124V probably benign Het
Lrch3 T C 16: 33,009,214 I738T probably damaging Het
Mgrn1 T G 16: 4,907,409 F44V probably damaging Het
Olfr366 A G 2: 37,219,639 Q50R probably benign Het
Otog G A 7: 46,259,911 V602M probably benign Het
Pik3r5 T G 11: 68,494,224 L652V probably benign Het
Pkdrej G A 15: 85,818,312 T1141M probably damaging Het
Sema3a T C 5: 13,523,175 probably benign Het
Syt3 A T 7: 44,392,667 I317F probably damaging Het
Tmem214 C T 5: 30,875,790 A509V probably damaging Het
Tmem25 T C 9: 44,795,232 E284G probably benign Het
Trim9 T C 12: 70,346,727 N148D probably damaging Het
Zfp964 A T 8: 69,664,018 I423L probably benign Het
Other mutations in Vmn2r107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Vmn2r107 APN 17 20375747 missense probably damaging 0.98
IGL01768:Vmn2r107 APN 17 20345606 missense probably benign 0.32
IGL02086:Vmn2r107 APN 17 20357800 missense probably benign 0.00
IGL02136:Vmn2r107 APN 17 20374906 missense probably benign 0.02
IGL02266:Vmn2r107 APN 17 20356777 missense probably damaging 1.00
IGL02285:Vmn2r107 APN 17 20375561 missense probably damaging 1.00
IGL02724:Vmn2r107 APN 17 20356744 missense possibly damaging 0.49
IGL02998:Vmn2r107 APN 17 20357755 missense probably damaging 0.99
IGL03089:Vmn2r107 APN 17 20375712 missense probably benign 0.05
IGL03284:Vmn2r107 APN 17 20356911 missense probably benign 0.07
IGL03307:Vmn2r107 APN 17 20356776 missense probably benign 0.09
IGL03399:Vmn2r107 APN 17 20357958 splice site probably benign
3-1:Vmn2r107 UTSW 17 20345504 missense probably benign
R0285:Vmn2r107 UTSW 17 20345611 missense probably benign 0.00
R0455:Vmn2r107 UTSW 17 20374823 splice site probably benign
R0497:Vmn2r107 UTSW 17 20375132 missense probably damaging 1.00
R0506:Vmn2r107 UTSW 17 20357759 missense probably benign
R0621:Vmn2r107 UTSW 17 20374990 missense probably benign 0.01
R0667:Vmn2r107 UTSW 17 20355654 missense possibly damaging 0.91
R1118:Vmn2r107 UTSW 17 20356598 missense probably benign 0.03
R1237:Vmn2r107 UTSW 17 20356685 nonsense probably null
R1485:Vmn2r107 UTSW 17 20374847 missense possibly damaging 0.95
R1783:Vmn2r107 UTSW 17 20356513 missense possibly damaging 0.51
R1873:Vmn2r107 UTSW 17 20345578 missense probably benign 0.10
R1974:Vmn2r107 UTSW 17 20355617 splice site probably null
R2009:Vmn2r107 UTSW 17 20375467 missense probably benign 0.01
R2029:Vmn2r107 UTSW 17 20375287 missense probably benign 0.01
R2164:Vmn2r107 UTSW 17 20375642 missense probably damaging 1.00
R2269:Vmn2r107 UTSW 17 20375555 missense possibly damaging 0.58
R3087:Vmn2r107 UTSW 17 20360345 missense probably benign 0.03
R3740:Vmn2r107 UTSW 17 20374889 missense probably benign 0.00
R3961:Vmn2r107 UTSW 17 20375455 missense probably damaging 1.00
R4031:Vmn2r107 UTSW 17 20375221 missense probably benign 0.00
R4270:Vmn2r107 UTSW 17 20355779 missense probably benign
R4963:Vmn2r107 UTSW 17 20375141 missense probably damaging 1.00
R5121:Vmn2r107 UTSW 17 20355753 missense probably benign 0.01
R5640:Vmn2r107 UTSW 17 20375164 missense probably damaging 1.00
R6007:Vmn2r107 UTSW 17 20375054 missense probably benign 0.19
R6238:Vmn2r107 UTSW 17 20345587 missense probably benign 0.43
R6298:Vmn2r107 UTSW 17 20355782 missense probably benign 0.00
R6467:Vmn2r107 UTSW 17 20375677 missense probably damaging 0.99
R6726:Vmn2r107 UTSW 17 20375375 missense probably damaging 0.96
R6782:Vmn2r107 UTSW 17 20356879 missense probably damaging 1.00
X0022:Vmn2r107 UTSW 17 20356968 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GGCAAATGAGTCAGGCTAGGTTTCAA -3'
(R):5'- GCGTCCCATCTCTACTTTGTGACAAAT -3'

Sequencing Primer
(F):5'- GTCATTGACTGATTACCTGAGC -3'
(R):5'- GGGGGACTTATTGAACACTATTGAC -3'
Posted On2014-01-15