Incidental Mutation 'R1205:Olfr347'
ID100378
Institutional Source Beutler Lab
Gene Symbol Olfr347
Ensembl Gene ENSMUSG00000111863
Gene Nameolfactory receptor 347
SynonymsGA_x6K02T2NLDC-33428755-33429693, MOR136-9
MMRRC Submission 039275-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R1205 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location36731902-36737640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36734755 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 145 (V145I)
Ref Sequence ENSEMBL: ENSMUSP00000151158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078761] [ENSMUST00000216882]
Predicted Effect probably benign
Transcript: ENSMUST00000078761
AA Change: V145I

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000077819
Gene: ENSMUSG00000111863
AA Change: V145I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.2e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.3e-5 PFAM
Pfam:7tm_1 41 290 1.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216882
AA Change: V145I

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 T A 10: 14,434,339 N774I probably damaging Het
BC005561 T C 5: 104,520,213 L867S probably benign Het
Bpifc T A 10: 85,981,304 D230V probably damaging Het
Chrna2 C T 14: 66,143,363 A27V probably benign Het
Duox1 C T 2: 122,327,925 Q630* probably null Het
Dzip3 C T 16: 48,951,681 G542R probably damaging Het
Epha3 ATGAACTGCT AT 16: 63,598,248 probably null Het
Fam208a A T 14: 27,461,318 D578V probably damaging Het
Fnip1 G T 11: 54,502,306 V523L possibly damaging Het
Hc T A 2: 35,003,524 D1225V possibly damaging Het
Hnrnpu C T 1: 178,332,169 probably benign Het
Ift172 C T 5: 31,285,792 V125I probably benign Het
Kcnip2 T A 19: 45,794,983 Q93L probably null Het
Kif27 A T 13: 58,344,205 H373Q probably benign Het
Kl T C 5: 150,980,688 S302P probably damaging Het
Lyst G A 13: 13,680,202 V2386I probably benign Het
Map4k4 G A 1: 40,003,844 A128T probably damaging Het
March6 A C 15: 31,469,673 M717R probably benign Het
Morc2b A G 17: 33,135,934 Y955H probably damaging Het
Myo7b A G 18: 31,994,342 S636P probably damaging Het
Neb T A 2: 52,222,984 D4266V probably damaging Het
Nynrin G A 14: 55,854,189 probably benign Het
Olfr1212 A T 2: 88,958,588 I41L probably benign Het
Olfr1457 T C 19: 13,095,535 I38V probably benign Het
Pcdh9 A G 14: 93,886,065 S890P probably benign Het
Pcnx G T 12: 81,956,243 D1052Y probably damaging Het
Pibf1 G A 14: 99,101,203 E52K probably damaging Het
Siglec1 T G 2: 131,080,464 S564R possibly damaging Het
Sin3a T A 9: 57,119,175 V1125E probably damaging Het
Slco4c1 G T 1: 96,867,888 D148E probably damaging Het
Spag6l A T 16: 16,787,307 L127Q probably damaging Het
Syne4 C A 7: 30,315,336 T68N probably damaging Het
Tas2r134 A G 2: 51,627,986 Y159C probably benign Het
Tmem132a C A 19: 10,859,084 R694L probably benign Het
Ttc28 C T 5: 111,285,769 P2192L probably benign Het
Ttc34 T G 4: 154,862,214 V857G probably benign Het
Ugt1a7c A T 1: 88,095,956 H279L probably benign Het
Vmn1r32 G A 6: 66,553,555 T79I probably benign Het
Vps13a A T 19: 16,640,541 V2960D probably damaging Het
Wee2 G T 6: 40,443,941 probably benign Het
Other mutations in Olfr347
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02190:Olfr347 APN 2 36734579 missense probably benign 0.03
IGL02417:Olfr347 APN 2 36734344 missense probably benign 0.13
IGL02488:Olfr347 APN 2 36734350 missense probably benign 0.36
IGL02878:Olfr347 APN 2 36734477 missense probably damaging 1.00
IGL03354:Olfr347 APN 2 36734512 missense possibly damaging 0.87
IGL03354:Olfr347 APN 2 36734513 missense possibly damaging 0.89
R0091:Olfr347 UTSW 2 36734905 missense probably damaging 1.00
R0107:Olfr347 UTSW 2 36734718 nonsense probably null
R0457:Olfr347 UTSW 2 36734533 missense probably benign 0.18
R0563:Olfr347 UTSW 2 36735001 nonsense probably null
R1599:Olfr347 UTSW 2 36734989 missense probably benign 0.01
R1668:Olfr347 UTSW 2 36735192 nonsense probably null
R1845:Olfr347 UTSW 2 36734842 missense probably damaging 0.99
R1856:Olfr347 UTSW 2 36734345 missense probably benign
R2165:Olfr347 UTSW 2 36734701 missense probably damaging 0.97
R4399:Olfr347 UTSW 2 36735230 missense probably benign 0.00
R4657:Olfr347 UTSW 2 36734403 nonsense probably null
R4684:Olfr347 UTSW 2 36734674 missense probably damaging 1.00
R4767:Olfr347 UTSW 2 36734323 start codon destroyed probably benign 0.02
R4988:Olfr347 UTSW 2 36734984 missense possibly damaging 0.94
R5058:Olfr347 UTSW 2 36734999 missense possibly damaging 0.52
R5103:Olfr347 UTSW 2 36734668 missense probably benign 0.23
R5140:Olfr347 UTSW 2 36734498 missense possibly damaging 0.59
R5587:Olfr347 UTSW 2 36734621 missense probably damaging 1.00
R5591:Olfr347 UTSW 2 36735232 missense probably benign
R6738:Olfr347 UTSW 2 36734432 missense probably benign 0.26
R7097:Olfr347 UTSW 2 36734424 missense not run
R7122:Olfr347 UTSW 2 36734424 missense not run
Predicted Primers PCR Primer
(F):5'- ATCATCCTGCTCATCAGGCTGGAC -3'
(R):5'- TGTACATCACAGCCACAATGGCATC -3'

Sequencing Primer
(F):5'- TATGCTGACACATAGTCAGTCC -3'
(R):5'- AGTCCAATGATGGCTCCATAG -3'
Posted On2014-01-15