Incidental Mutation 'R1208:Tbpl2'
ID100498
Institutional Source Beutler Lab
Gene Symbol Tbpl2
Ensembl Gene ENSMUSG00000061809
Gene NameTATA box binding protein like 2
SynonymsLOC227606, Trf3
MMRRC Submission 039277-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.670) question?
Stock #R1208 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location24071721-24096595 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24094771 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 120 (N120K)
Ref Sequence ENSEMBL: ENSMUSP00000120310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080453] [ENSMUST00000153338]
Predicted Effect probably benign
Transcript: ENSMUST00000080453
AA Change: N121K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000079309
Gene: ENSMUSG00000061809
AA Change: N121K

DomainStartEndE-ValueType
Pfam:TBP 173 255 1.2e-33 PFAM
Pfam:TBP 263 347 1.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153338
AA Change: N120K

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000120310
Gene: ENSMUSG00000061809
AA Change: N120K

DomainStartEndE-ValueType
Pfam:TBP 171 255 3.1e-34 PFAM
Pfam:TBP 260 346 8.3e-36 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.8%
  • 10x: 91.7%
  • 20x: 74.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele exhibit infertility due to impaired folliculogenesis before or during secondary follicle development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A T 16: 30,354,247 C271S probably benign Het
Ccl25 T A 8: 4,357,631 S199T possibly damaging Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cep104 A T 4: 153,985,379 D270V probably damaging Het
Dnah5 T A 15: 28,327,731 Y2084N probably damaging Het
Eftud2 A G 11: 102,864,766 V214A probably benign Het
Epb41l4b C T 4: 57,077,252 probably null Het
Fam129c A T 8: 71,600,475 T125S probably damaging Het
Gm8298 C T 3: 59,865,294 P73L probably benign Het
Golgb1 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 16: 36,915,205 probably null Het
Gys2 A G 6: 142,450,467 probably null Het
Lig4 T C 8: 9,971,062 E906G probably damaging Het
Mast3 G A 8: 70,788,272 probably null Het
Mta2 G A 19: 8,951,017 R560H probably damaging Het
Myom2 T C 8: 15,084,631 L478P probably damaging Het
Neb A T 2: 52,303,900 L673* probably null Het
Olfr1260 G A 2: 89,978,492 C238Y probably damaging Het
Pdpk1 C A 17: 24,093,609 probably null Het
Perm1 T C 4: 156,217,002 M1T probably null Het
Pphln1 T C 15: 93,459,729 W162R probably damaging Het
Ppp1r13b A G 12: 111,844,905 V183A probably damaging Het
Recql5 T C 11: 115,893,156 K951E probably damaging Het
Slc25a25 T C 2: 32,417,425 E309G probably benign Het
Sycp2 A T 2: 178,356,628 I1033N possibly damaging Het
Unc5b A T 10: 60,766,992 L876Q probably damaging Het
Usp9y T C Y: 1,356,282 T1140A probably benign Het
Vmn1r40 A G 6: 89,714,344 I48V probably benign Het
Zbbx T C 3: 75,037,992 I708V possibly damaging Het
Zfp318 AGAAGA AGAAGAGGAAGA 17: 46,412,520 probably benign Het
Other mutations in Tbpl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Tbpl2 APN 2 24094973 missense probably benign 0.08
IGL02273:Tbpl2 APN 2 24096519 missense probably benign 0.00
IGL02887:Tbpl2 APN 2 24093876 missense probably damaging 0.99
IGL02969:Tbpl2 APN 2 24091093 missense probably damaging 1.00
IGL03075:Tbpl2 APN 2 24071985 utr 3 prime probably benign
IGL03107:Tbpl2 APN 2 24093833 missense probably benign 0.01
IGL03118:Tbpl2 APN 2 24087289 missense probably benign 0.22
R0322:Tbpl2 UTSW 2 24094979 missense probably benign 0.00
R1208:Tbpl2 UTSW 2 24094771 missense probably benign 0.02
R1699:Tbpl2 UTSW 2 24095045 missense probably benign 0.00
R1987:Tbpl2 UTSW 2 24094732 missense probably benign
R2040:Tbpl2 UTSW 2 24094859 missense probably benign 0.00
R3500:Tbpl2 UTSW 2 24087139 missense probably benign 0.00
R3819:Tbpl2 UTSW 2 24076012 missense probably damaging 1.00
R3937:Tbpl2 UTSW 2 24087139 missense probably benign 0.00
R4995:Tbpl2 UTSW 2 24093860 missense possibly damaging 0.94
R5033:Tbpl2 UTSW 2 24087158 missense probably benign 0.01
R5606:Tbpl2 UTSW 2 24087233 missense possibly damaging 0.67
R6049:Tbpl2 UTSW 2 24094992 missense possibly damaging 0.75
R6153:Tbpl2 UTSW 2 24076016 missense probably damaging 1.00
R6260:Tbpl2 UTSW 2 24094886 missense possibly damaging 0.94
R6347:Tbpl2 UTSW 2 24094703 missense probably benign 0.35
R6936:Tbpl2 UTSW 2 24094941 missense probably benign 0.00
R7378:Tbpl2 UTSW 2 24094700 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CCAAATCAAACTCCGTTGTGTTTACCC -3'
(R):5'- AGGCATCCACTGACTTTTCATCTGTG -3'

Sequencing Primer
(F):5'- agaagaaggggaaggaggac -3'
(R):5'- GGATCTAAGCTTCTTACCAGATGAAC -3'
Posted On2014-01-15