Incidental Mutation 'R1208:Olfr1260'
ID100504
Institutional Source Beutler Lab
Gene Symbol Olfr1260
Ensembl Gene ENSMUSG00000042894
Gene Nameolfactory receptor 1260
SynonymsGA_x6K02T2Q125-51409740-51410672, MOR232-2
MMRRC Submission 039277-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R1208 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89974340-89981586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 89978492 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 238 (C238Y)
Ref Sequence ENSEMBL: ENSMUSP00000107137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061830] [ENSMUST00000111512] [ENSMUST00000144710] [ENSMUST00000214630] [ENSMUST00000216678]
Predicted Effect probably damaging
Transcript: ENSMUST00000061830
AA Change: C238Y

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000053523
Gene: ENSMUSG00000042894
AA Change: C238Y

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.7e-45 PFAM
Pfam:7tm_1 39 285 1.7e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111512
AA Change: C238Y

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107137
Gene: ENSMUSG00000042894
AA Change: C238Y

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 7.4e-27 PFAM
Pfam:7tm_4 137 278 2.4e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144613
Predicted Effect probably benign
Transcript: ENSMUST00000144710
SMART Domains Protein: ENSMUSP00000119512
Gene: ENSMUSG00000042894

DomainStartEndE-ValueType
Pfam:7tm_1 39 121 4.2e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213162
Predicted Effect probably benign
Transcript: ENSMUST00000214630
Predicted Effect probably benign
Transcript: ENSMUST00000216678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216744
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.8%
  • 10x: 91.7%
  • 20x: 74.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A T 16: 30,354,247 C271S probably benign Het
Ccl25 T A 8: 4,357,631 S199T possibly damaging Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cep104 A T 4: 153,985,379 D270V probably damaging Het
Dnah5 T A 15: 28,327,731 Y2084N probably damaging Het
Eftud2 A G 11: 102,864,766 V214A probably benign Het
Epb41l4b C T 4: 57,077,252 probably null Het
Fam129c A T 8: 71,600,475 T125S probably damaging Het
Gm8298 C T 3: 59,865,294 P73L probably benign Het
Golgb1 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 16: 36,915,205 probably null Het
Gys2 A G 6: 142,450,467 probably null Het
Lig4 T C 8: 9,971,062 E906G probably damaging Het
Mast3 G A 8: 70,788,272 probably null Het
Mta2 G A 19: 8,951,017 R560H probably damaging Het
Myom2 T C 8: 15,084,631 L478P probably damaging Het
Neb A T 2: 52,303,900 L673* probably null Het
Pdpk1 C A 17: 24,093,609 probably null Het
Perm1 T C 4: 156,217,002 M1T probably null Het
Pphln1 T C 15: 93,459,729 W162R probably damaging Het
Ppp1r13b A G 12: 111,844,905 V183A probably damaging Het
Recql5 T C 11: 115,893,156 K951E probably damaging Het
Slc25a25 T C 2: 32,417,425 E309G probably benign Het
Sycp2 A T 2: 178,356,628 I1033N possibly damaging Het
Tbpl2 A T 2: 24,094,771 N120K probably benign Het
Unc5b A T 10: 60,766,992 L876Q probably damaging Het
Usp9y T C Y: 1,356,282 T1140A probably benign Het
Vmn1r40 A G 6: 89,714,344 I48V probably benign Het
Zbbx T C 3: 75,037,992 I708V possibly damaging Het
Zfp318 AGAAGA AGAAGAGGAAGA 17: 46,412,520 probably benign Het
Other mutations in Olfr1260
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Olfr1260 APN 2 89978539 missense possibly damaging 0.69
IGL01657:Olfr1260 APN 2 89977877 missense probably damaging 1.00
IGL01942:Olfr1260 APN 2 89977978 missense probably benign 0.03
IGL02139:Olfr1260 APN 2 89978429 missense possibly damaging 0.80
IGL02926:Olfr1260 APN 2 89978162 missense probably damaging 1.00
IGL03110:Olfr1260 APN 2 89978149 missense probably damaging 1.00
IGL03368:Olfr1260 APN 2 89977789 missense probably benign
R0046:Olfr1260 UTSW 2 89978507 missense probably damaging 1.00
R0046:Olfr1260 UTSW 2 89978507 missense probably damaging 1.00
R0087:Olfr1260 UTSW 2 89978131 missense probably damaging 1.00
R0599:Olfr1260 UTSW 2 89978201 missense probably benign 0.01
R1208:Olfr1260 UTSW 2 89978492 missense probably damaging 0.99
R1424:Olfr1260 UTSW 2 89978071 nonsense probably null
R1503:Olfr1260 UTSW 2 89978528 missense probably damaging 0.99
R1708:Olfr1260 UTSW 2 89978038 missense probably benign 0.00
R1863:Olfr1260 UTSW 2 89978410 missense probably benign 0.02
R1866:Olfr1260 UTSW 2 89978327 missense probably damaging 1.00
R2072:Olfr1260 UTSW 2 89978213 missense probably benign 0.04
R2219:Olfr1260 UTSW 2 89977912 missense possibly damaging 0.62
R4606:Olfr1260 UTSW 2 89978006 missense possibly damaging 0.79
R4674:Olfr1260 UTSW 2 89977906 missense possibly damaging 0.52
R4825:Olfr1260 UTSW 2 89978153 missense probably damaging 1.00
R5822:Olfr1260 UTSW 2 89978443 missense probably damaging 1.00
R6487:Olfr1260 UTSW 2 89977838 missense probably benign 0.31
R6706:Olfr1260 UTSW 2 89978585 missense probably damaging 0.96
X0050:Olfr1260 UTSW 2 89978016 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGTTGCCTTTCTGTGGCCCAAATA -3'
(R):5'- CCCAGGTTTTCTTTGGTTCCAGAGT -3'

Sequencing Primer
(F):5'- CTGTGGCCCAAATATCATTGAC -3'
(R):5'- GTTCCAGAGTTTTCTCATGGC -3'
Posted On2014-01-15