Incidental Mutation 'R1208:Gys2'
ID100520
Institutional Source Beutler Lab
Gene Symbol Gys2
Ensembl Gene ENSMUSG00000030244
Gene Nameglycogen synthase 2
Synonymsglycogen synthase, liver, LGS
MMRRC Submission 039277-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock #R1208 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location142422613-142473109 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 142450467 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032371]
Predicted Effect probably null
Transcript: ENSMUST00000032371
SMART Domains Protein: ENSMUSP00000032371
Gene: ENSMUSG00000030244

DomainStartEndE-ValueType
Pfam:Glycogen_syn 32 667 N/A PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.8%
  • 10x: 91.7%
  • 20x: 74.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, liver glycogen synthase, catalyzes the rate-limiting step in the synthesis of glycogen - the transfer of a glucose molecule from UDP-glucose to a terminal branch of the glycogen molecule. Mutations in this gene cause glycogen storage disease type 0 (GSD-0) - a rare type of early childhood fasting hypoglycemia with decreased liver glycogen content. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a conditional allele knocked out in the liver results in abnormal glycogen homeostasis, altered glucose homeostasis, decreased exercise endurance, and a phenotype similar to patients with glycogen storage disease 0. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A T 16: 30,354,247 C271S probably benign Het
Ccl25 T A 8: 4,357,631 S199T possibly damaging Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cep104 A T 4: 153,985,379 D270V probably damaging Het
Dnah5 T A 15: 28,327,731 Y2084N probably damaging Het
Eftud2 A G 11: 102,864,766 V214A probably benign Het
Epb41l4b C T 4: 57,077,252 probably null Het
Fam129c A T 8: 71,600,475 T125S probably damaging Het
Gm8298 C T 3: 59,865,294 P73L probably benign Het
Golgb1 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 16: 36,915,205 probably null Het
Lig4 T C 8: 9,971,062 E906G probably damaging Het
Mast3 G A 8: 70,788,272 probably null Het
Mta2 G A 19: 8,951,017 R560H probably damaging Het
Myom2 T C 8: 15,084,631 L478P probably damaging Het
Neb A T 2: 52,303,900 L673* probably null Het
Olfr1260 G A 2: 89,978,492 C238Y probably damaging Het
Pdpk1 C A 17: 24,093,609 probably null Het
Perm1 T C 4: 156,217,002 M1T probably null Het
Pphln1 T C 15: 93,459,729 W162R probably damaging Het
Ppp1r13b A G 12: 111,844,905 V183A probably damaging Het
Recql5 T C 11: 115,893,156 K951E probably damaging Het
Slc25a25 T C 2: 32,417,425 E309G probably benign Het
Sycp2 A T 2: 178,356,628 I1033N possibly damaging Het
Tbpl2 A T 2: 24,094,771 N120K probably benign Het
Unc5b A T 10: 60,766,992 L876Q probably damaging Het
Usp9y T C Y: 1,356,282 T1140A probably benign Het
Vmn1r40 A G 6: 89,714,344 I48V probably benign Het
Zbbx T C 3: 75,037,992 I708V possibly damaging Het
Zfp318 AGAAGA AGAAGAGGAAGA 17: 46,412,520 probably benign Het
Other mutations in Gys2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Gys2 APN 6 142463290 nonsense probably null
IGL02963:Gys2 APN 6 142449428 critical splice donor site probably null
IGL02997:Gys2 APN 6 142449469 missense probably damaging 1.00
candy_corn UTSW 6 142456333 missense probably benign 0.00
embittered UTSW 6 142454484 missense possibly damaging 0.92
hazelnut UTSW 6 142449455 missense possibly damaging 0.67
R0243:Gys2 UTSW 6 142472668 splice site probably benign
R1124:Gys2 UTSW 6 142446013 missense probably damaging 0.97
R1188:Gys2 UTSW 6 142455183 missense probably damaging 1.00
R1208:Gys2 UTSW 6 142450467 critical splice donor site probably null
R1235:Gys2 UTSW 6 142430293 missense probably damaging 1.00
R1387:Gys2 UTSW 6 142461283 missense probably benign 0.06
R1758:Gys2 UTSW 6 142472706 missense probably damaging 1.00
R1819:Gys2 UTSW 6 142461186 missense probably damaging 1.00
R2221:Gys2 UTSW 6 142456422 missense probably damaging 1.00
R2311:Gys2 UTSW 6 142463244 missense possibly damaging 0.81
R2344:Gys2 UTSW 6 142446022 missense probably damaging 0.99
R3151:Gys2 UTSW 6 142456333 missense probably benign 0.00
R3902:Gys2 UTSW 6 142472800 start codon destroyed probably null 0.98
R4532:Gys2 UTSW 6 142455141 missense probably damaging 0.98
R4577:Gys2 UTSW 6 142454510 missense possibly damaging 0.93
R4588:Gys2 UTSW 6 142449455 missense possibly damaging 0.67
R4606:Gys2 UTSW 6 142454484 missense possibly damaging 0.92
R5338:Gys2 UTSW 6 142454513 missense probably damaging 1.00
R5411:Gys2 UTSW 6 142448421 missense probably damaging 0.99
R6072:Gys2 UTSW 6 142428537 missense probably damaging 0.98
R6261:Gys2 UTSW 6 142459408 missense probably benign
R6366:Gys2 UTSW 6 142463394 missense probably benign 0.02
R6597:Gys2 UTSW 6 142456309 missense probably benign 0.25
R6930:Gys2 UTSW 6 142459380 critical splice donor site probably null
R7033:Gys2 UTSW 6 142472722 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCCTGTGAATGGTGAAGCCCTAA -3'
(R):5'- GGAATGGTAATGAGACAACAGCACCT -3'

Sequencing Primer
(F):5'- tcccccaaccataaattattttcatc -3'
(R):5'- ccaagcattcacagtagcag -3'
Posted On2014-01-15