Incidental Mutation 'R1208:Ppp1r13b'
ID100544
Institutional Source Beutler Lab
Gene Symbol Ppp1r13b
Ensembl Gene ENSMUSG00000021285
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 13B
SynonymsASPP1
MMRRC Submission 039277-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.791) question?
Stock #R1208 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location111828457-111908110 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111844905 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 183 (V183A)
Ref Sequence ENSEMBL: ENSMUSP00000062464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054815] [ENSMUST00000220486]
Predicted Effect probably damaging
Transcript: ENSMUST00000054815
AA Change: V183A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062464
Gene: ENSMUSG00000021285
AA Change: V183A

DomainStartEndE-ValueType
PDB:2UWQ|A 1 83 8e-35 PDB
Blast:RA 5 84 3e-47 BLAST
coiled coil region 123 305 N/A INTRINSIC
low complexity region 437 476 N/A INTRINSIC
low complexity region 523 539 N/A INTRINSIC
low complexity region 610 625 N/A INTRINSIC
PDB:4IRV|H 695 741 1e-12 PDB
ANK 917 946 4.16e-7 SMART
ANK 950 979 4.63e-5 SMART
SH3 1019 1077 1.79e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220486
AA Change: V25A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.8%
  • 10x: 91.7%
  • 20x: 74.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ASPP (apoptosis-stimulating protein of p53) family of p53 interacting proteins. The protein contains four ankyrin repeats and an SH3 domain involved in protein-protein interactions. ASPP proteins are required for the induction of apoptosis by p53-family proteins. They promote DNA binding and transactivation of p53-family proteins on the promoters of proapoptotic genes. Expression of this gene is regulated by the E2F transcription factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants show lymphatic vascular phenotypes with subcutaneous edema detected only during embryogenesis, delayed lymphatic vessel formation, and mispatterned collecting lymphatic vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A T 16: 30,354,247 C271S probably benign Het
Ccl25 T A 8: 4,357,631 S199T possibly damaging Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cep104 A T 4: 153,985,379 D270V probably damaging Het
Dnah5 T A 15: 28,327,731 Y2084N probably damaging Het
Eftud2 A G 11: 102,864,766 V214A probably benign Het
Epb41l4b C T 4: 57,077,252 probably null Het
Fam129c A T 8: 71,600,475 T125S probably damaging Het
Gm8298 C T 3: 59,865,294 P73L probably benign Het
Golgb1 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 16: 36,915,205 probably null Het
Gys2 A G 6: 142,450,467 probably null Het
Lig4 T C 8: 9,971,062 E906G probably damaging Het
Mast3 G A 8: 70,788,272 probably null Het
Mta2 G A 19: 8,951,017 R560H probably damaging Het
Myom2 T C 8: 15,084,631 L478P probably damaging Het
Neb A T 2: 52,303,900 L673* probably null Het
Olfr1260 G A 2: 89,978,492 C238Y probably damaging Het
Pdpk1 C A 17: 24,093,609 probably null Het
Perm1 T C 4: 156,217,002 M1T probably null Het
Pphln1 T C 15: 93,459,729 W162R probably damaging Het
Recql5 T C 11: 115,893,156 K951E probably damaging Het
Slc25a25 T C 2: 32,417,425 E309G probably benign Het
Sycp2 A T 2: 178,356,628 I1033N possibly damaging Het
Tbpl2 A T 2: 24,094,771 N120K probably benign Het
Unc5b A T 10: 60,766,992 L876Q probably damaging Het
Usp9y T C Y: 1,356,282 T1140A probably benign Het
Vmn1r40 A G 6: 89,714,344 I48V probably benign Het
Zbbx T C 3: 75,037,992 I708V possibly damaging Het
Zfp318 AGAAGA AGAAGAGGAAGA 17: 46,412,520 probably benign Het
Other mutations in Ppp1r13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Ppp1r13b APN 12 111829370 missense probably damaging 0.99
IGL01102:Ppp1r13b APN 12 111833219 missense probably benign
IGL01621:Ppp1r13b APN 12 111835092 missense possibly damaging 0.50
IGL01677:Ppp1r13b APN 12 111843665 missense probably benign 0.18
IGL01720:Ppp1r13b APN 12 111858260 missense probably benign 0.05
IGL01921:Ppp1r13b APN 12 111833237 missense probably benign
IGL02059:Ppp1r13b APN 12 111833347 missense probably damaging 1.00
IGL02187:Ppp1r13b APN 12 111835038 missense probably damaging 0.99
IGL02262:Ppp1r13b APN 12 111835211 missense possibly damaging 0.88
IGL02385:Ppp1r13b APN 12 111835043 missense probably damaging 1.00
IGL02894:Ppp1r13b APN 12 111831454 unclassified probably benign
IGL03027:Ppp1r13b APN 12 111830396 nonsense probably null
IGL03049:Ppp1r13b APN 12 111833229 missense probably benign 0.29
PIT4468001:Ppp1r13b UTSW 12 111838702 missense probably benign 0.08
PIT4472001:Ppp1r13b UTSW 12 111832640 missense probably damaging 1.00
R0393:Ppp1r13b UTSW 12 111835688 missense probably benign 0.01
R0561:Ppp1r13b UTSW 12 111866446 missense probably damaging 1.00
R1067:Ppp1r13b UTSW 12 111835116 missense probably damaging 1.00
R1208:Ppp1r13b UTSW 12 111844905 missense probably damaging 1.00
R1512:Ppp1r13b UTSW 12 111872408 missense possibly damaging 0.84
R1563:Ppp1r13b UTSW 12 111840982 missense probably damaging 1.00
R1918:Ppp1r13b UTSW 12 111834810 missense probably damaging 1.00
R2014:Ppp1r13b UTSW 12 111833788 missense probably benign
R2134:Ppp1r13b UTSW 12 111833733 missense probably benign 0.00
R2306:Ppp1r13b UTSW 12 111844893 missense probably damaging 1.00
R3508:Ppp1r13b UTSW 12 111872367 missense probably damaging 1.00
R3767:Ppp1r13b UTSW 12 111846417 missense probably damaging 0.99
R4237:Ppp1r13b UTSW 12 111838736 missense probably benign
R4278:Ppp1r13b UTSW 12 111830384 missense probably damaging 0.96
R4690:Ppp1r13b UTSW 12 111832558 missense probably damaging 1.00
R4702:Ppp1r13b UTSW 12 111833281 missense probably benign 0.00
R5094:Ppp1r13b UTSW 12 111843610 missense probably benign 0.00
R5250:Ppp1r13b UTSW 12 111844960 missense probably benign 0.20
R5444:Ppp1r13b UTSW 12 111838688 missense probably benign
R5607:Ppp1r13b UTSW 12 111833789 missense probably benign 0.44
R5874:Ppp1r13b UTSW 12 111844989 missense probably damaging 1.00
R5935:Ppp1r13b UTSW 12 111830442 missense probably benign
R6074:Ppp1r13b UTSW 12 111832402 missense probably damaging 1.00
R6253:Ppp1r13b UTSW 12 111835726 missense probably benign
R6511:Ppp1r13b UTSW 12 111831567 missense probably damaging 1.00
R6836:Ppp1r13b UTSW 12 111835195 missense probably benign 0.16
R6968:Ppp1r13b UTSW 12 111833178 missense possibly damaging 0.76
R7269:Ppp1r13b UTSW 12 111834919 missense probably damaging 0.99
R7284:Ppp1r13b UTSW 12 111834966 missense possibly damaging 0.82
R7304:Ppp1r13b UTSW 12 111872406 missense possibly damaging 0.49
R7314:Ppp1r13b UTSW 12 111846356 missense probably damaging 1.00
X0010:Ppp1r13b UTSW 12 111831459 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGGTTAGAAACGTGCAGTGCC -3'
(R):5'- TGACGTGTGCAGAATTCCTTCAGTG -3'

Sequencing Primer
(F):5'- AAACGTGCAGTGCCATTTG -3'
(R):5'- GCAGAATTCCTTCAGTGTTCTTTAG -3'
Posted On2014-01-15