Incidental Mutation 'R1209:Fmo3'
ID100567
Institutional Source Beutler Lab
Gene Symbol Fmo3
Ensembl Gene ENSMUSG00000026691
Gene Nameflavin containing monooxygenase 3
Synonyms
MMRRC Submission 039278-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.046) question?
Stock #R1209 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location162953800-162984528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 162964028 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 227 (D227N)
Ref Sequence ENSEMBL: ENSMUSP00000028010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028010]
Predicted Effect probably benign
Transcript: ENSMUST00000028010
AA Change: D227N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000028010
Gene: ENSMUSG00000026691
AA Change: D227N

DomainStartEndE-ValueType
Pfam:FMO-like 2 534 7.7e-286 PFAM
Pfam:Pyr_redox_2 3 245 4.4e-15 PFAM
Pfam:Pyr_redox_3 6 220 1.1e-11 PFAM
Pfam:NAD_binding_8 7 71 3.1e-7 PFAM
Pfam:K_oxygenase 79 224 6.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142759
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.2%
  • 20x: 85.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Flavin-containing monooxygenases (FMO) are an important class of drug-metabolizing enzymes that catalyze the NADPH-dependent oxygenation of various nitrogen-,sulfur-, and phosphorous-containing xenobiotics such as therapeutic drugs, dietary compounds, pesticides, and other foreign compounds. The human FMO gene family is composed of 5 genes and multiple pseudogenes. FMO members have distinct developmental- and tissue-specific expression patterns. The expression of this FMO3 gene, the major FMO expressed in adult liver, can vary up to 20-fold between individuals. This inter-individual variation in FMO3 expression levels is likely to have significant effects on the rate at which xenobiotics are metabolised and, therefore, is of considerable interest to the pharmaceutical industry. This transmembrane protein localizes to the endoplasmic reticulum of many tissues. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. Mutations in this gene cause the disorder trimethylaminuria (TMAu) which is characterized by the accumulation and excretion of unmetabolized trimethylamine and a distinctive body odor. In healthy individuals, trimethylamine is primarily converted to the non odorous trimethylamine N-oxide.[provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,191,064 probably null Het
Ahi1 A G 10: 20,963,730 D180G probably damaging Het
Banp G A 8: 121,975,917 V30I possibly damaging Het
Btn2a2 C T 13: 23,480,566 probably null Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cdhr1 C T 14: 37,082,942 probably null Het
Cfap44 T C 16: 44,422,417 I728T possibly damaging Het
Fbn2 A G 18: 58,070,016 M1212T probably benign Het
Klk5 G T 7: 43,846,998 R118L probably damaging Het
Krtap4-1 A G 11: 99,628,157 V9A unknown Het
Muc5b A G 7: 141,857,910 N1531S unknown Het
Mypn A G 10: 63,118,499 S1234P probably damaging Het
Nme5 A G 18: 34,569,896 L113S probably damaging Het
Olfr1275 T C 2: 111,231,613 Y60C probably damaging Het
Olfr53 A G 7: 140,652,014 T12A probably benign Het
Oprk1 T C 1: 5,602,261 V207A probably benign Het
Otop2 A G 11: 115,324,643 E130G possibly damaging Het
Pard6a A G 8: 105,702,391 K78R probably benign Het
Pbrm1 T A 14: 31,118,852 L1637H probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rnaset2b T A 17: 6,979,076 C27S probably benign Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Speer4a T C 5: 26,035,125 probably null Het
Srsf4 A G 4: 131,901,059 probably benign Het
Syt11 G A 3: 88,747,840 R79C probably damaging Het
Tbx3 T C 5: 119,680,953 V531A probably benign Het
Tmem132d T A 5: 127,784,870 D729V probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Other mutations in Fmo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Fmo3 APN 1 162964030 missense probably benign 0.15
IGL01124:Fmo3 APN 1 162958261 missense probably damaging 1.00
IGL01645:Fmo3 APN 1 162964006 missense possibly damaging 0.53
IGL01710:Fmo3 APN 1 162983043 missense probably damaging 1.00
IGL01943:Fmo3 APN 1 162967006 missense probably benign 0.01
IGL02489:Fmo3 APN 1 162954287 missense possibly damaging 0.75
IGL02503:Fmo3 APN 1 162968864 missense probably benign 0.03
IGL02743:Fmo3 APN 1 162958483 missense probably damaging 1.00
IGL02974:Fmo3 APN 1 162983050 missense probably damaging 1.00
IGL03023:Fmo3 APN 1 162958465 missense probably benign 0.00
R0554:Fmo3 UTSW 1 162954332 missense probably benign 0.03
R0629:Fmo3 UTSW 1 162958227 splice site probably benign
R1213:Fmo3 UTSW 1 162967823 missense probably damaging 1.00
R1612:Fmo3 UTSW 1 162967885 missense probably damaging 1.00
R1636:Fmo3 UTSW 1 162954425 missense probably benign
R1710:Fmo3 UTSW 1 162967787 missense possibly damaging 0.59
R1764:Fmo3 UTSW 1 162958573 missense possibly damaging 0.79
R1775:Fmo3 UTSW 1 162968725 missense possibly damaging 0.54
R1906:Fmo3 UTSW 1 162966906 missense probably damaging 1.00
R2363:Fmo3 UTSW 1 162954315 missense probably damaging 0.98
R2418:Fmo3 UTSW 1 162966958 missense probably benign
R2519:Fmo3 UTSW 1 162958305 missense probably damaging 1.00
R3940:Fmo3 UTSW 1 162963986 missense probably benign 0.01
R3977:Fmo3 UTSW 1 162958578 missense probably damaging 0.99
R4779:Fmo3 UTSW 1 162968838 missense probably damaging 1.00
R4846:Fmo3 UTSW 1 162954311 missense possibly damaging 0.94
R4892:Fmo3 UTSW 1 162968731 missense probably benign 0.00
R5102:Fmo3 UTSW 1 162963977 missense probably benign 0.01
R5516:Fmo3 UTSW 1 162954426 nonsense probably null
R6035:Fmo3 UTSW 1 162964036 missense probably damaging 0.97
R6035:Fmo3 UTSW 1 162964036 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGCCCATCACGTTTTAGTCCCTG -3'
(R):5'- TGCTCTTAGAGTCAGTGTCTCCCAG -3'

Sequencing Primer
(F):5'- AGTCCCTGTTACCTGTTTAAAGG -3'
(R):5'- GGcaaaaacaaaacaaaacaaaaac -3'
Posted On2014-01-15