Incidental Mutation 'R1209:Olfr1275'
ID100569
Institutional Source Beutler Lab
Gene Symbol Olfr1275
Ensembl Gene ENSMUSG00000074966
Gene Nameolfactory receptor 1275
SynonymsGA_x6K02T2Q125-72283260-72282322, MOR245-18
MMRRC Submission 039278-MU
Accession Numbers

Genbank: NM_001011795; MGI: 3031109

Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1209 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location111230360-111235286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111231613 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 60 (Y60C)
Ref Sequence ENSEMBL: ENSMUSP00000150515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028577] [ENSMUST00000099620] [ENSMUST00000216421] [ENSMUST00000217539]
Predicted Effect probably benign
Transcript: ENSMUST00000028577
SMART Domains Protein: ENSMUSP00000028577
Gene: ENSMUSG00000027157

DomainStartEndE-ValueType
ANK 78 107 1.61e-4 SMART
ANK 111 140 3.6e-2 SMART
ANK 144 173 4.89e-4 SMART
ANK 177 206 4.03e-5 SMART
ANK 210 239 8.72e-1 SMART
Blast:ANK 243 272 4e-12 BLAST
low complexity region 460 472 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099620
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097215
Gene: ENSMUSG00000074966
AA Change: Y60C

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 9.8e-37 PFAM
Pfam:7tm_1 41 287 5.6e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216421
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217539
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.2%
  • 20x: 85.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,191,064 probably null Het
Ahi1 A G 10: 20,963,730 D180G probably damaging Het
Banp G A 8: 121,975,917 V30I possibly damaging Het
Btn2a2 C T 13: 23,480,566 probably null Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cdhr1 C T 14: 37,082,942 probably null Het
Cfap44 T C 16: 44,422,417 I728T possibly damaging Het
Fbn2 A G 18: 58,070,016 M1212T probably benign Het
Fmo3 C T 1: 162,964,028 D227N probably benign Het
Klk5 G T 7: 43,846,998 R118L probably damaging Het
Krtap4-1 A G 11: 99,628,157 V9A unknown Het
Muc5b A G 7: 141,857,910 N1531S unknown Het
Mypn A G 10: 63,118,499 S1234P probably damaging Het
Nme5 A G 18: 34,569,896 L113S probably damaging Het
Olfr53 A G 7: 140,652,014 T12A probably benign Het
Oprk1 T C 1: 5,602,261 V207A probably benign Het
Otop2 A G 11: 115,324,643 E130G possibly damaging Het
Pard6a A G 8: 105,702,391 K78R probably benign Het
Pbrm1 T A 14: 31,118,852 L1637H probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rnaset2b T A 17: 6,979,076 C27S probably benign Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Speer4a T C 5: 26,035,125 probably null Het
Srsf4 A G 4: 131,901,059 probably benign Het
Syt11 G A 3: 88,747,840 R79C probably damaging Het
Tbx3 T C 5: 119,680,953 V531A probably benign Het
Tmem132d T A 5: 127,784,870 D729V probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Other mutations in Olfr1275
AlleleSourceChrCoordTypePredicted EffectPPH Score
3-1:Olfr1275 UTSW 2 111231463 missense possibly damaging 0.77
R0477:Olfr1275 UTSW 2 111231664 missense probably benign 0.00
R1780:Olfr1275 UTSW 2 111231698 missense probably benign
R5386:Olfr1275 UTSW 2 111231194 missense probably benign 0.05
R5637:Olfr1275 UTSW 2 111231111 missense probably benign 0.26
R5819:Olfr1275 UTSW 2 111230959 missense probably damaging 1.00
R6007:Olfr1275 UTSW 2 111230930 missense probably benign 0.30
R6414:Olfr1275 UTSW 2 111231152 unclassified probably null
R6557:Olfr1275 UTSW 2 111231631 missense probably benign 0.01
R6864:Olfr1275 UTSW 2 111231197 missense probably benign 0.26
R7035:Olfr1275 UTSW 2 111231439 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACATATCTGTCCCAGGCCAT -3'
(R):5'- TTCTGCCAGAAACTGGATCACTGTC -3'

Sequencing Primer
(F):5'- TGGCTACCAGCAACACCATC -3'
(R):5'- GATCTGAATAACTGAAGACAGCTC -3'
Posted On2014-01-15