Incidental Mutation 'R1163:Gbp2b'
ID100576
Institutional Source Beutler Lab
Gene Symbol Gbp2b
Ensembl Gene ENSMUSG00000040264
Gene Nameguanylate binding protein 2b
SynonymsGbp1, Mpa1, Mag-1, Gbp-1, Mpa-1
MMRRC Submission 039236-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1163 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location142594847-142619179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142599096 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 98 (T98A)
Ref Sequence ENSEMBL: ENSMUSP00000029936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029936]
Predicted Effect probably damaging
Transcript: ENSMUST00000029936
AA Change: T98A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029936
Gene: ENSMUSG00000040264
AA Change: T98A

DomainStartEndE-ValueType
Pfam:GBP 18 280 4.1e-122 PFAM
Pfam:GBP_C 282 578 5.5e-125 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanylate-binding protein (GBP) family. GBPs specifically bind guanine nucleotides (GMP, GDP, and GTP) and contain two of the three consensus motifs found in typical GTP-binding proteins. The encoded protein interacts with a member of the germinal center kinase family. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T A 10: 87,121,422 Y7N probably damaging Het
4930579F01Rik T G 3: 138,176,510 D18A probably damaging Het
Abca8a T C 11: 110,071,530 D499G probably benign Het
Adamts1 G C 16: 85,802,637 A25G probably benign Het
Adamts2 A T 11: 50,779,714 I552F probably damaging Het
Akap3 A G 6: 126,864,787 D123G probably damaging Het
Ankar C T 1: 72,688,705 V350I possibly damaging Het
Apob A G 12: 8,011,654 T3379A probably damaging Het
Ash1l G T 3: 89,035,263 probably null Het
Atp2b1 T C 10: 98,979,851 I119T possibly damaging Het
B3gnt2 A T 11: 22,836,558 M210K probably benign Het
Bcl11a A G 11: 24,165,143 N829D probably benign Het
Btnl4 T C 17: 34,470,075 E337G possibly damaging Het
Casr A T 16: 36,494,807 V967D probably damaging Het
Cd200 A T 16: 45,392,352 V244D probably damaging Het
Cd200r4 A G 16: 44,838,020 N256D probably benign Het
Cep68 A G 11: 20,240,539 S158P probably damaging Het
Chst10 A T 1: 38,871,702 V123D probably damaging Het
Cobll1 T C 2: 65,098,279 H938R probably damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Dmkn T G 7: 30,765,051 C205G probably damaging Het
Dock8 A G 19: 25,051,503 I24V probably benign Het
Dpp3 C T 19: 4,914,923 W488* probably null Het
Dpp9 C A 17: 56,199,426 A365S possibly damaging Het
Egfr A T 11: 16,883,546 T605S probably benign Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Fam83g T C 11: 61,703,436 S599P probably damaging Het
Fscn1 G T 5: 142,960,843 W132L probably damaging Het
Gm13088 A G 4: 143,656,634 L5P probably damaging Het
Gm4922 C T 10: 18,783,721 A418T possibly damaging Het
Golgb1 G T 16: 36,916,126 V1912L possibly damaging Het
Gon4l T C 3: 88,892,535 L829P probably damaging Het
Grm3 T A 5: 9,570,738 I169L probably benign Het
Gsdma2 A G 11: 98,650,858 D137G probably damaging Het
Hhip T C 8: 79,992,476 Y474C probably damaging Het
Hsph1 A T 5: 149,630,801 V163E probably damaging Het
Ifi203 T C 1: 173,924,137 K373E probably damaging Het
Itsn2 A G 12: 4,712,009 T1540A probably benign Het
Kdm1b T C 13: 47,071,922 V527A probably benign Het
Kdm5d G A Y: 898,029 A22T probably benign Het
Khdrbs1 A T 4: 129,725,586 F254Y possibly damaging Het
Kif26a T C 12: 112,179,945 F1822L probably benign Het
Krt1 C A 15: 101,848,165 E308* probably null Het
Lrrc47 T A 4: 154,011,817 M1K probably null Het
Mrgpra4 A T 7: 47,981,476 W126R probably damaging Het
Nlrp4e G A 7: 23,320,972 V295I probably benign Het
Olfr1100 A G 2: 86,978,676 L40P probably damaging Het
Olfr1258 G T 2: 89,930,105 V99F possibly damaging Het
Olfr1446 T A 19: 12,890,149 T143S probably benign Het
Olfr201 A G 16: 59,269,155 S171P probably benign Het
Olfr206 A T 16: 59,345,062 I213N probably damaging Het
Olfr228 A T 2: 86,483,238 F168Y probably damaging Het
Olfr364-ps1 A T 2: 37,147,027 T272S probably damaging Het
Olfr453 G A 6: 42,744,123 V29I probably benign Het
Olfr798 A G 10: 129,625,647 V138A possibly damaging Het
Plec G T 15: 76,183,838 N1190K possibly damaging Het
Plin1 T C 7: 79,729,971 T44A probably damaging Het
Pou3f2 TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 4: 22,487,697 probably benign Het
Psg27 A G 7: 18,565,309 L29P probably damaging Het
Psmd13 C A 7: 140,897,454 T292N probably damaging Het
Rab1b A T 19: 5,104,656 Y88* probably null Het
Reln T A 5: 21,899,029 I3315L probably benign Het
Rmdn2 A T 17: 79,659,451 M257L probably benign Het
Rnd1 A T 15: 98,676,554 F47L probably damaging Het
Rnf41 G A 10: 128,438,207 V243I probably benign Het
Rnf43 C G 11: 87,729,513 S226R probably damaging Het
Scn5a A T 9: 119,533,927 D542E probably damaging Het
Sema5b A T 16: 35,628,096 I81F probably benign Het
Serinc5 G A 13: 92,682,777 C73Y probably damaging Het
Serpina3g A T 12: 104,239,292 N97Y possibly damaging Het
Shq1 A G 6: 100,637,072 S262P probably damaging Het
Smad4 A T 18: 73,648,907 I428N probably damaging Het
Snip1 G T 4: 125,072,820 G348W probably damaging Het
Spg11 A G 2: 122,070,941 L1506P probably damaging Het
Stard9 G A 2: 120,696,213 V984I possibly damaging Het
Svopl A T 6: 38,029,700 F121I possibly damaging Het
Tjp1 A T 7: 65,323,054 V546E probably damaging Het
Tmem116 T A 5: 121,493,756 F110L probably damaging Het
Ttyh2 C T 11: 114,710,888 T446M probably benign Het
Tubb1 A T 2: 174,457,739 I405L probably benign Het
Uba5 A T 9: 104,055,826 F155L possibly damaging Het
Ubd C T 17: 37,195,321 H33Y probably damaging Het
Ube2cbp A T 9: 86,440,595 D175E probably benign Het
Usp24 A G 4: 106,420,960 Q2293R probably benign Het
Vmn1r175 T A 7: 23,808,512 H230L probably benign Het
Vmn1r88 A G 7: 13,178,133 I139V probably benign Het
Vmn2r1 T C 3: 64,086,625 F131L probably benign Het
Yipf3 T C 17: 46,251,229 probably null Het
Zdhhc19 A G 16: 32,506,440 K192R probably benign Het
Zfy1 G A Y: 725,611 T718I probably damaging Het
Other mutations in Gbp2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Gbp2b APN 3 142598312 missense probably damaging 1.00
IGL01892:Gbp2b APN 3 142603620 missense probably benign 0.03
IGL01989:Gbp2b APN 3 142611440 missense probably benign 0.19
IGL02019:Gbp2b APN 3 142606990 missense possibly damaging 0.52
IGL02338:Gbp2b APN 3 142604226 missense probably benign 0.09
IGL02657:Gbp2b APN 3 142604112 missense probably damaging 1.00
IGL03148:Gbp2b APN 3 142606881 missense probably benign 0.00
FR4304:Gbp2b UTSW 3 142603652 missense probably benign 0.00
FR4340:Gbp2b UTSW 3 142603652 missense probably benign 0.00
FR4342:Gbp2b UTSW 3 142603652 missense probably benign 0.00
FR4589:Gbp2b UTSW 3 142603652 missense probably benign 0.00
R0329:Gbp2b UTSW 3 142608176 missense probably benign 0.01
R0345:Gbp2b UTSW 3 142608183 missense probably damaging 1.00
R0358:Gbp2b UTSW 3 142606789 missense probably damaging 1.00
R0732:Gbp2b UTSW 3 142606978 missense probably benign
R1550:Gbp2b UTSW 3 142606830 missense probably damaging 0.99
R1629:Gbp2b UTSW 3 142610974 missense possibly damaging 0.93
R1886:Gbp2b UTSW 3 142608302 missense probably benign
R1887:Gbp2b UTSW 3 142608302 missense probably benign
R2188:Gbp2b UTSW 3 142608279 missense probably benign 0.44
R2261:Gbp2b UTSW 3 142606735 missense probably benign 0.00
R3977:Gbp2b UTSW 3 142603709 missense probably benign 0.02
R4718:Gbp2b UTSW 3 142598995 missense probably damaging 1.00
R4788:Gbp2b UTSW 3 142611410 missense probably benign 0.21
R4807:Gbp2b UTSW 3 142598245 missense probably benign 0.02
R5042:Gbp2b UTSW 3 142611463 missense probably benign 0.03
R5087:Gbp2b UTSW 3 142598254 missense probably damaging 1.00
R5114:Gbp2b UTSW 3 142598185 missense probably damaging 1.00
R5414:Gbp2b UTSW 3 142599091 missense probably damaging 1.00
R5567:Gbp2b UTSW 3 142611365 missense possibly damaging 0.75
R5625:Gbp2b UTSW 3 142599045 missense probably damaging 1.00
R5685:Gbp2b UTSW 3 142608158 missense probably benign
R6030:Gbp2b UTSW 3 142603653 missense probably benign 0.00
R6030:Gbp2b UTSW 3 142603653 missense probably benign 0.00
R6408:Gbp2b UTSW 3 142618138 missense probably benign 0.00
R6500:Gbp2b UTSW 3 142611491 missense probably benign 0.06
R6581:Gbp2b UTSW 3 142608238 nonsense probably null
R6582:Gbp2b UTSW 3 142611040 missense possibly damaging 0.53
R6847:Gbp2b UTSW 3 142598179 missense probably damaging 0.96
R6923:Gbp2b UTSW 3 142600559 missense probably benign 0.01
R7120:Gbp2b UTSW 3 142606746 missense probably benign 0.01
Predicted Primers
Posted On2014-01-15