Incidental Mutation 'R1163:Reln'
ID100592
Institutional Source Beutler Lab
Gene Symbol Reln
Ensembl Gene ENSMUSG00000042453
Gene Namereelin
Synonyms
MMRRC Submission 039236-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R1163 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location21884454-22344702 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21899029 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 3315 (I3315L)
Ref Sequence ENSEMBL: ENSMUSP00000124052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]
Predicted Effect probably benign
Transcript: ENSMUST00000062372
AA Change: I3315L

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: I3315L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 40 172 6.1e-24 PFAM
internal_repeat_3 195 360 5.04e-6 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3450 3457 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160791
Predicted Effect probably benign
Transcript: ENSMUST00000161356
AA Change: I3315L

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: I3315L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 54 171 2.9e-10 PFAM
internal_repeat_3 195 360 5.06e-6 PROSPERO
internal_repeat_2 207 413 3.41e-11 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
internal_repeat_2 1452 1660 3.41e-11 PROSPERO
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3452 3459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200667
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T A 10: 87,121,422 Y7N probably damaging Het
4930579F01Rik T G 3: 138,176,510 D18A probably damaging Het
Abca8a T C 11: 110,071,530 D499G probably benign Het
Adamts1 G C 16: 85,802,637 A25G probably benign Het
Adamts2 A T 11: 50,779,714 I552F probably damaging Het
Akap3 A G 6: 126,864,787 D123G probably damaging Het
Ankar C T 1: 72,688,705 V350I possibly damaging Het
Apob A G 12: 8,011,654 T3379A probably damaging Het
Ash1l G T 3: 89,035,263 probably null Het
Atp2b1 T C 10: 98,979,851 I119T possibly damaging Het
B3gnt2 A T 11: 22,836,558 M210K probably benign Het
Bcl11a A G 11: 24,165,143 N829D probably benign Het
Btnl4 T C 17: 34,470,075 E337G possibly damaging Het
Casr A T 16: 36,494,807 V967D probably damaging Het
Cd200 A T 16: 45,392,352 V244D probably damaging Het
Cd200r4 A G 16: 44,838,020 N256D probably benign Het
Cep68 A G 11: 20,240,539 S158P probably damaging Het
Chst10 A T 1: 38,871,702 V123D probably damaging Het
Cobll1 T C 2: 65,098,279 H938R probably damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Dmkn T G 7: 30,765,051 C205G probably damaging Het
Dock8 A G 19: 25,051,503 I24V probably benign Het
Dpp3 C T 19: 4,914,923 W488* probably null Het
Dpp9 C A 17: 56,199,426 A365S possibly damaging Het
Egfr A T 11: 16,883,546 T605S probably benign Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Fam83g T C 11: 61,703,436 S599P probably damaging Het
Fscn1 G T 5: 142,960,843 W132L probably damaging Het
Gbp2b A G 3: 142,599,096 T98A probably damaging Het
Gm13088 A G 4: 143,656,634 L5P probably damaging Het
Gm4922 C T 10: 18,783,721 A418T possibly damaging Het
Golgb1 G T 16: 36,916,126 V1912L possibly damaging Het
Gon4l T C 3: 88,892,535 L829P probably damaging Het
Grm3 T A 5: 9,570,738 I169L probably benign Het
Gsdma2 A G 11: 98,650,858 D137G probably damaging Het
Hhip T C 8: 79,992,476 Y474C probably damaging Het
Hsph1 A T 5: 149,630,801 V163E probably damaging Het
Ifi203 T C 1: 173,924,137 K373E probably damaging Het
Itsn2 A G 12: 4,712,009 T1540A probably benign Het
Kdm1b T C 13: 47,071,922 V527A probably benign Het
Kdm5d G A Y: 898,029 A22T probably benign Het
Khdrbs1 A T 4: 129,725,586 F254Y possibly damaging Het
Kif26a T C 12: 112,179,945 F1822L probably benign Het
Krt1 C A 15: 101,848,165 E308* probably null Het
Lrrc47 T A 4: 154,011,817 M1K probably null Het
Mrgpra4 A T 7: 47,981,476 W126R probably damaging Het
Nlrp4e G A 7: 23,320,972 V295I probably benign Het
Olfr1100 A G 2: 86,978,676 L40P probably damaging Het
Olfr1258 G T 2: 89,930,105 V99F possibly damaging Het
Olfr1446 T A 19: 12,890,149 T143S probably benign Het
Olfr201 A G 16: 59,269,155 S171P probably benign Het
Olfr206 A T 16: 59,345,062 I213N probably damaging Het
Olfr228 A T 2: 86,483,238 F168Y probably damaging Het
Olfr364-ps1 A T 2: 37,147,027 T272S probably damaging Het
Olfr453 G A 6: 42,744,123 V29I probably benign Het
Olfr798 A G 10: 129,625,647 V138A possibly damaging Het
Plec G T 15: 76,183,838 N1190K possibly damaging Het
Plin1 T C 7: 79,729,971 T44A probably damaging Het
Pou3f2 TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 4: 22,487,697 probably benign Het
Psg27 A G 7: 18,565,309 L29P probably damaging Het
Psmd13 C A 7: 140,897,454 T292N probably damaging Het
Rab1b A T 19: 5,104,656 Y88* probably null Het
Rmdn2 A T 17: 79,659,451 M257L probably benign Het
Rnd1 A T 15: 98,676,554 F47L probably damaging Het
Rnf41 G A 10: 128,438,207 V243I probably benign Het
Rnf43 C G 11: 87,729,513 S226R probably damaging Het
Scn5a A T 9: 119,533,927 D542E probably damaging Het
Sema5b A T 16: 35,628,096 I81F probably benign Het
Serinc5 G A 13: 92,682,777 C73Y probably damaging Het
Serpina3g A T 12: 104,239,292 N97Y possibly damaging Het
Shq1 A G 6: 100,637,072 S262P probably damaging Het
Smad4 A T 18: 73,648,907 I428N probably damaging Het
Snip1 G T 4: 125,072,820 G348W probably damaging Het
Spg11 A G 2: 122,070,941 L1506P probably damaging Het
Stard9 G A 2: 120,696,213 V984I possibly damaging Het
Svopl A T 6: 38,029,700 F121I possibly damaging Het
Tjp1 A T 7: 65,323,054 V546E probably damaging Het
Tmem116 T A 5: 121,493,756 F110L probably damaging Het
Ttyh2 C T 11: 114,710,888 T446M probably benign Het
Tubb1 A T 2: 174,457,739 I405L probably benign Het
Uba5 A T 9: 104,055,826 F155L possibly damaging Het
Ubd C T 17: 37,195,321 H33Y probably damaging Het
Ube2cbp A T 9: 86,440,595 D175E probably benign Het
Usp24 A G 4: 106,420,960 Q2293R probably benign Het
Vmn1r175 T A 7: 23,808,512 H230L probably benign Het
Vmn1r88 A G 7: 13,178,133 I139V probably benign Het
Vmn2r1 T C 3: 64,086,625 F131L probably benign Het
Yipf3 T C 17: 46,251,229 probably null Het
Zdhhc19 A G 16: 32,506,440 K192R probably benign Het
Zfy1 G A Y: 725,611 T718I probably damaging Het
Other mutations in Reln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Reln APN 5 22039565 missense possibly damaging 0.57
IGL00091:Reln APN 5 22039565 missense possibly damaging 0.57
IGL00432:Reln APN 5 22010127 missense probably damaging 1.00
IGL00433:Reln APN 5 22045009 missense probably damaging 1.00
IGL00576:Reln APN 5 22154950 missense probably benign 0.01
IGL00755:Reln APN 5 22060380 missense probably damaging 0.98
IGL00777:Reln APN 5 22018850 critical splice donor site probably null
IGL00900:Reln APN 5 21980117 missense probably damaging 0.98
IGL01067:Reln APN 5 21979666 missense probably damaging 1.00
IGL01104:Reln APN 5 21986967 missense probably damaging 0.99
IGL01141:Reln APN 5 21969033 missense probably damaging 1.00
IGL01141:Reln APN 5 21919069 missense probably damaging 1.00
IGL01333:Reln APN 5 22171251 missense probably damaging 0.99
IGL01341:Reln APN 5 21969079 missense probably damaging 1.00
IGL01354:Reln APN 5 21919175 nonsense probably null
IGL01361:Reln APN 5 21919021 missense probably benign 0.06
IGL01446:Reln APN 5 21969317 missense probably damaging 0.99
IGL01448:Reln APN 5 22040405 missense probably benign 0.40
IGL01612:Reln APN 5 21896930 missense probably damaging 0.99
IGL01695:Reln APN 5 21920438 missense probably damaging 1.00
IGL01718:Reln APN 5 21947514 missense possibly damaging 0.60
IGL01749:Reln APN 5 22344246 nonsense probably null
IGL01875:Reln APN 5 21904717 missense probably benign
IGL02013:Reln APN 5 21950879 missense probably damaging 1.00
IGL02031:Reln APN 5 21979016 missense probably damaging 0.99
IGL02186:Reln APN 5 21909958 missense probably damaging 1.00
IGL02228:Reln APN 5 21904731 missense probably damaging 0.99
IGL02248:Reln APN 5 21910992 missense probably damaging 1.00
IGL02336:Reln APN 5 21929134 missense probably damaging 1.00
IGL02352:Reln APN 5 22039565 missense possibly damaging 0.57
IGL02359:Reln APN 5 22039565 missense possibly damaging 0.57
IGL02376:Reln APN 5 22080791 nonsense probably null
IGL02408:Reln APN 5 21901619 missense probably benign 0.44
IGL02415:Reln APN 5 21971951 missense possibly damaging 0.91
IGL02512:Reln APN 5 22040427 missense probably benign 0.00
IGL02540:Reln APN 5 22034752 missense probably damaging 0.96
IGL02624:Reln APN 5 22103357 missense probably benign 0.09
IGL02720:Reln APN 5 21997941 missense probably damaging 0.99
IGL02894:Reln APN 5 21885548 missense possibly damaging 0.72
IGL02999:Reln APN 5 21995365 missense probably damaging 1.00
IGL03125:Reln APN 5 21910844 missense probably damaging 1.00
IGL03298:Reln APN 5 21910836 missense probably damaging 0.99
fishing UTSW 5 21896841 missense probably damaging 1.00
P0020:Reln UTSW 5 22106060 missense possibly damaging 0.91
R0018:Reln UTSW 5 21925371 missense probably benign 0.01
R0105:Reln UTSW 5 22048815 missense probably damaging 0.99
R0105:Reln UTSW 5 22048815 missense probably damaging 0.99
R0127:Reln UTSW 5 22004136 missense probably damaging 1.00
R0135:Reln UTSW 5 22128649 missense probably damaging 0.99
R0144:Reln UTSW 5 21948449 missense probably damaging 0.97
R0240:Reln UTSW 5 22106045 missense probably benign 0.36
R0240:Reln UTSW 5 22106045 missense probably benign 0.36
R0242:Reln UTSW 5 21942597 critical splice donor site probably null
R0242:Reln UTSW 5 21942597 critical splice donor site probably null
R0266:Reln UTSW 5 21988776 missense probably damaging 1.00
R0269:Reln UTSW 5 21920537 missense probably damaging 1.00
R0280:Reln UTSW 5 22227513 splice site probably benign
R0333:Reln UTSW 5 21929242 missense probably damaging 0.97
R0357:Reln UTSW 5 21950822 missense probably damaging 1.00
R0359:Reln UTSW 5 22048800 missense probably damaging 0.98
R0506:Reln UTSW 5 21920496 missense probably damaging 0.97
R0534:Reln UTSW 5 21947408 missense probably damaging 0.99
R0535:Reln UTSW 5 22051276 splice site probably benign
R0541:Reln UTSW 5 21980109 missense possibly damaging 0.88
R0615:Reln UTSW 5 22010150 missense probably benign 0.36
R0617:Reln UTSW 5 21920537 missense probably damaging 1.00
R0634:Reln UTSW 5 22018869 missense probably damaging 1.00
R0653:Reln UTSW 5 21913230 missense probably benign 0.44
R0704:Reln UTSW 5 21896811 missense probably damaging 0.99
R0706:Reln UTSW 5 21896811 missense probably damaging 0.99
R0959:Reln UTSW 5 22227628 missense probably damaging 0.96
R1066:Reln UTSW 5 22034664 missense probably damaging 1.00
R1110:Reln UTSW 5 22034775 missense probably benign
R1222:Reln UTSW 5 21986955 missense probably null 0.97
R1226:Reln UTSW 5 21910866 missense probably damaging 1.00
R1440:Reln UTSW 5 22128602 splice site probably benign
R1532:Reln UTSW 5 22034744 missense probably damaging 0.99
R1552:Reln UTSW 5 21960378 missense probably benign 0.01
R1565:Reln UTSW 5 21925213 missense probably benign 0.05
R1618:Reln UTSW 5 22060368 missense probably benign 0.01
R1636:Reln UTSW 5 21998683 missense probably damaging 0.99
R1664:Reln UTSW 5 21929086 missense probably damaging 1.00
R1716:Reln UTSW 5 21955095 missense probably damaging 0.98
R1759:Reln UTSW 5 22010289 missense probably damaging 0.99
R1835:Reln UTSW 5 21979002 missense probably damaging 1.00
R1907:Reln UTSW 5 22044962 critical splice donor site probably null
R1991:Reln UTSW 5 21969360 missense possibly damaging 0.56
R2046:Reln UTSW 5 21942627 missense probably benign 0.01
R2072:Reln UTSW 5 21919177 missense probably damaging 1.00
R2103:Reln UTSW 5 21969360 missense possibly damaging 0.56
R2119:Reln UTSW 5 22019000 missense probably damaging 1.00
R2120:Reln UTSW 5 21969085 missense probably damaging 1.00
R2216:Reln UTSW 5 22048005 missense probably benign 0.30
R2219:Reln UTSW 5 21972047 missense possibly damaging 0.88
R2228:Reln UTSW 5 21987078 missense possibly damaging 0.69
R2306:Reln UTSW 5 21896786 missense probably damaging 1.00
R2316:Reln UTSW 5 22154956 missense probably benign 0.00
R2321:Reln UTSW 5 21915020 missense probably damaging 0.99
R2512:Reln UTSW 5 21979690 missense possibly damaging 0.89
R2519:Reln UTSW 5 22344369 missense unknown
R2870:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2870:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2871:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2871:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2872:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2872:Reln UTSW 5 22049791 missense possibly damaging 0.95
R3195:Reln UTSW 5 22040420 missense possibly damaging 0.72
R3545:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3546:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3547:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3706:Reln UTSW 5 21995589 splice site probably benign
R3713:Reln UTSW 5 21904734 missense probably damaging 0.99
R3770:Reln UTSW 5 21948566 missense probably damaging 1.00
R3836:Reln UTSW 5 21911014 missense probably damaging 1.00
R3887:Reln UTSW 5 21910849 missense possibly damaging 0.92
R3972:Reln UTSW 5 21979001 missense probably damaging 0.99
R3975:Reln UTSW 5 21995366 missense possibly damaging 0.57
R4022:Reln UTSW 5 22227630 missense probably benign 0.45
R4044:Reln UTSW 5 22128632 missense possibly damaging 0.82
R4107:Reln UTSW 5 22034584 missense probably damaging 1.00
R4297:Reln UTSW 5 21920487 missense probably damaging 0.99
R4298:Reln UTSW 5 21920487 missense probably damaging 0.99
R4299:Reln UTSW 5 21920487 missense probably damaging 0.99
R4518:Reln UTSW 5 21901743 missense probably benign 0.44
R4615:Reln UTSW 5 21972872 missense possibly damaging 0.95
R4713:Reln UTSW 5 22152463 missense probably benign 0.17
R4720:Reln UTSW 5 22286896 missense possibly damaging 0.71
R4721:Reln UTSW 5 21919222 missense probably damaging 0.99
R4771:Reln UTSW 5 22049700 missense probably damaging 1.00
R4794:Reln UTSW 5 22344185 missense probably damaging 0.98
R4840:Reln UTSW 5 22018846 splice site probably null
R4860:Reln UTSW 5 21901751 missense probably benign 0.06
R4860:Reln UTSW 5 21901751 missense probably benign 0.06
R4896:Reln UTSW 5 21955238 missense probably damaging 1.00
R4908:Reln UTSW 5 21979720 missense probably benign 0.02
R4912:Reln UTSW 5 21925193 missense probably benign 0.29
R4922:Reln UTSW 5 21995587 critical splice acceptor site probably null
R4975:Reln UTSW 5 21960426 missense probably damaging 1.00
R4976:Reln UTSW 5 21971870 missense probably benign 0.05
R5020:Reln UTSW 5 22034638 missense probably damaging 1.00
R5037:Reln UTSW 5 21948512 missense probably damaging 1.00
R5082:Reln UTSW 5 21896077 missense probably benign 0.00
R5119:Reln UTSW 5 21971870 missense probably benign 0.05
R5125:Reln UTSW 5 21913241 missense possibly damaging 0.78
R5137:Reln UTSW 5 21955181 missense probably damaging 1.00
R5152:Reln UTSW 5 21948629 missense probably damaging 1.00
R5154:Reln UTSW 5 21988765 missense probably damaging 0.99
R5259:Reln UTSW 5 22103397 missense possibly damaging 0.83
R5283:Reln UTSW 5 22011163 missense probably damaging 1.00
R5386:Reln UTSW 5 22039529 missense probably benign
R5400:Reln UTSW 5 21979714 missense probably damaging 1.00
R5478:Reln UTSW 5 22004203 missense probably benign 0.00
R5514:Reln UTSW 5 21971885 missense possibly damaging 0.93
R5529:Reln UTSW 5 21932715 missense possibly damaging 0.71
R5611:Reln UTSW 5 22039665 nonsense probably null
R5648:Reln UTSW 5 21998572 missense probably benign 0.04
R5649:Reln UTSW 5 21901625 missense probably benign 0.33
R5744:Reln UTSW 5 22106083 missense probably null 0.39
R5782:Reln UTSW 5 22018056 missense probably benign 0.01
R5815:Reln UTSW 5 21947433 missense probably damaging 0.99
R5838:Reln UTSW 5 21899113 missense probably damaging 0.97
R6162:Reln UTSW 5 21911050 missense probably damaging 1.00
R6219:Reln UTSW 5 21948596 missense probably damaging 1.00
R6259:Reln UTSW 5 22060333 missense probably damaging 0.99
R6279:Reln UTSW 5 21896841 missense probably damaging 1.00
R6299:Reln UTSW 5 22286944 missense possibly damaging 0.71
R6300:Reln UTSW 5 21896841 missense probably damaging 1.00
R6314:Reln UTSW 5 22152484 nonsense probably null
R6351:Reln UTSW 5 21901663 nonsense probably null
R6369:Reln UTSW 5 22051361 missense probably benign 0.03
R6371:Reln UTSW 5 21995513 missense probably benign
R6374:Reln UTSW 5 22080714 missense probably benign 0.06
R6425:Reln UTSW 5 21911020 nonsense probably null
R6442:Reln UTSW 5 21932776 missense probably benign
R6445:Reln UTSW 5 21919214 missense probably benign 0.05
R6554:Reln UTSW 5 21896840 missense probably damaging 1.00
R6641:Reln UTSW 5 21929134 missense probably damaging 1.00
R6768:Reln UTSW 5 21978907 missense probably damaging 0.99
R6859:Reln UTSW 5 22034570 missense probably damaging 1.00
R6896:Reln UTSW 5 21899179 missense probably benign 0.18
R6932:Reln UTSW 5 21985857 missense probably benign 0.00
R6948:Reln UTSW 5 21972035 missense probably damaging 1.00
R6959:Reln UTSW 5 21976564 missense probably damaging 1.00
Predicted Primers
Posted On2014-01-15