Incidental Mutation 'R1209:Btn2a2'
ID100611
Institutional Source Beutler Lab
Gene Symbol Btn2a2
Ensembl Gene ENSMUSG00000053216
Gene Namebutyrophilin, subfamily 2, member A2
Synonyms
MMRRC Submission 039278-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R1209 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23477676-23488857 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 23480566 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041541] [ENSMUST00000110432] [ENSMUST00000110433] [ENSMUST00000223877]
Predicted Effect probably null
Transcript: ENSMUST00000041541
SMART Domains Protein: ENSMUSP00000048251
Gene: ENSMUSG00000053216

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 37 144 9.12e-7 SMART
Pfam:C2-set_2 148 231 3.3e-8 PFAM
transmembrane domain 250 272 N/A INTRINSIC
coiled coil region 276 304 N/A INTRINSIC
PRY 312 364 1.87e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110432
SMART Domains Protein: ENSMUSP00000106062
Gene: ENSMUSG00000053216

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 37 144 9.12e-7 SMART
Blast:IG_like 151 211 1e-29 BLAST
transmembrane domain 250 272 N/A INTRINSIC
coiled coil region 276 304 N/A INTRINSIC
PRY 312 364 1.87e-27 SMART
SPRY 365 485 3.56e-34 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110433
SMART Domains Protein: ENSMUSP00000106063
Gene: ENSMUSG00000053216

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 37 144 9.12e-7 SMART
Pfam:C2-set_2 148 231 1.2e-8 PFAM
transmembrane domain 250 272 N/A INTRINSIC
coiled coil region 276 304 N/A INTRINSIC
PRY 312 364 1.87e-27 SMART
SPRY 365 485 3.56e-34 SMART
Predicted Effect probably null
Transcript: ENSMUST00000223877
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.2%
  • 20x: 85.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Butyrophilin is the major protein associated with fat droplets in the milk. This gene is a member of the BTN2 subfamily of genes, which encode proteins belonging to the butyrophilin protein family. The gene is located in a cluster on chromosome 6, consisting of seven genes belonging to the expanding B7/butyrophilin-like group, a subset of the immunoglobulin gene superfamily. The encoded protein is a type I receptor glycoprotein involved in lipid, fatty-acid and sterol metabolism. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,191,064 probably null Het
Ahi1 A G 10: 20,963,730 D180G probably damaging Het
Banp G A 8: 121,975,917 V30I possibly damaging Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cdhr1 C T 14: 37,082,942 probably null Het
Cfap44 T C 16: 44,422,417 I728T possibly damaging Het
Fbn2 A G 18: 58,070,016 M1212T probably benign Het
Fmo3 C T 1: 162,964,028 D227N probably benign Het
Klk5 G T 7: 43,846,998 R118L probably damaging Het
Krtap4-1 A G 11: 99,628,157 V9A unknown Het
Muc5b A G 7: 141,857,910 N1531S unknown Het
Mypn A G 10: 63,118,499 S1234P probably damaging Het
Nme5 A G 18: 34,569,896 L113S probably damaging Het
Olfr1275 T C 2: 111,231,613 Y60C probably damaging Het
Olfr53 A G 7: 140,652,014 T12A probably benign Het
Oprk1 T C 1: 5,602,261 V207A probably benign Het
Otop2 A G 11: 115,324,643 E130G possibly damaging Het
Pard6a A G 8: 105,702,391 K78R probably benign Het
Pbrm1 T A 14: 31,118,852 L1637H probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rnaset2b T A 17: 6,979,076 C27S probably benign Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Speer4a T C 5: 26,035,125 probably null Het
Srsf4 A G 4: 131,901,059 probably benign Het
Syt11 G A 3: 88,747,840 R79C probably damaging Het
Tbx3 T C 5: 119,680,953 V531A probably benign Het
Tmem132d T A 5: 127,784,870 D729V probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Other mutations in Btn2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Btn2a2 APN 13 23478576 missense probably damaging 1.00
IGL00740:Btn2a2 APN 13 23478485 missense probably benign
IGL02053:Btn2a2 APN 13 23478820 missense probably damaging 1.00
IGL02720:Btn2a2 APN 13 23480467 missense probably benign 0.15
IGL02738:Btn2a2 APN 13 23478806 nonsense probably null
IGL03010:Btn2a2 APN 13 23486205 nonsense probably null
IGL03221:Btn2a2 APN 13 23478449 missense probably damaging 1.00
R0066:Btn2a2 UTSW 13 23478485 missense probably benign 0.01
R0066:Btn2a2 UTSW 13 23478485 missense probably benign 0.01
R0597:Btn2a2 UTSW 13 23486410 missense probably benign 0.12
R0749:Btn2a2 UTSW 13 23478398 makesense probably null
R1283:Btn2a2 UTSW 13 23478832 missense probably damaging 0.98
R1718:Btn2a2 UTSW 13 23481936 missense probably benign 0.01
R2925:Btn2a2 UTSW 13 23481814 missense probably damaging 1.00
R3824:Btn2a2 UTSW 13 23480465 missense probably benign 0.02
R5281:Btn2a2 UTSW 13 23478832 missense probably damaging 0.98
R5356:Btn2a2 UTSW 13 23482875 missense probably benign 0.02
R5482:Btn2a2 UTSW 13 23486387 missense probably benign 0.03
R5535:Btn2a2 UTSW 13 23478275 missense probably benign 0.14
R5629:Btn2a2 UTSW 13 23481960 splice site probably null
R5930:Btn2a2 UTSW 13 23486228 missense probably damaging 0.96
R5952:Btn2a2 UTSW 13 23482808 missense probably benign 0.09
R6006:Btn2a2 UTSW 13 23486363 missense probably damaging 1.00
R6196:Btn2a2 UTSW 13 23487845 missense possibly damaging 0.74
R6373:Btn2a2 UTSW 13 23481829 missense probably benign 0.00
R6533:Btn2a2 UTSW 13 23481781 nonsense probably null
R6891:Btn2a2 UTSW 13 23482844 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ACTCCAGGACCCTTGAGTCTTTTGT -3'
(R):5'- ccttctgagccaccGTGATCAAAT -3'

Sequencing Primer
(F):5'- GACCCTTGAGTCTTTTGTTCATGTC -3'
(R):5'- actaaccctgaacatctctcac -3'
Posted On2014-01-15