Mutagenetix > Incidental Mutation

Incidental Mutation 'R1209:Cdhr1'

100619

Institutional Source

Beutler Lab

Gene Symbol

Cdhr1

Ensembl Gene

ENSMUSG00000021803

Gene Name

cadherin-related family member 1

Synonyms

Prcad, Pcdh21

MMRRC Submission

039278-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.132) question?

Stock #

R1209 (G1)

Quality Score

165

Status

Not validated

Chromosome

Chromosomal Location

36799814-36820304 bp(-) (GRCm39)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 36804899 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000022337 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022337]

AlphaFold

Q8VHP6

Predicted Effect

probably null
Transcript: ENSMUST00000022337

SMART Domains

Protein: ENSMUSP00000022337
Gene: ENSMUSG00000021803

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CA	57	133	9.4e-7	SMART
CA	157	245	9.44e-21	SMART
CA	269	352	2.06e-12	SMART
CA	383	471	2.68e-11	SMART
CA	495	575	5.26e-19	SMART
CA	594	685	1.64e-6	SMART
transmembrane domain	703	725	N/A	INTRINSIC
low complexity region	734	745	N/A	INTRINSIC
low complexity region	789	799	N/A	INTRINSIC
low complexity region	817	829	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 97.8%
10x: 94.2%
20x: 85.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the cadherin superfamily of calcium-dependent cell adhesion molecules. The encoded protein is a photoreceptor-specific cadherin that plays a role in outer segment disc morphogenesis. Mutations in this gene are associated with inherited retinal dystrophies. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit progressive degeneration of retinal photoreceptor cells and a slight reduction in light responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahi1	A	G	10: 20,839,629 (GRCm39)	D180G	probably damaging	Het
Aopep	A	G	13: 63,338,878 (GRCm39)		probably null	Het
Banp	G	A	8: 122,702,656 (GRCm39)	V30I	possibly damaging	Het
Btn2a2	C	T	13: 23,664,736 (GRCm39)		probably null	Het
Cdh15	G	C	8: 123,584,234 (GRCm39)	E112Q	probably damaging	Het
Cfap44	T	C	16: 44,242,780 (GRCm39)	I728T	possibly damaging	Het
Fbn2	A	G	18: 58,203,088 (GRCm39)	M1212T	probably benign	Het
Fmo3	C	T	1: 162,791,597 (GRCm39)	D227N	probably benign	Het
Klk1b5	G	T	7: 43,496,422 (GRCm39)	R118L	probably damaging	Het
Krtap4-1	A	G	11: 99,518,983 (GRCm39)	V9A	unknown	Het
Muc5b	A	G	7: 141,411,647 (GRCm39)	N1531S	unknown	Het
Mypn	A	G	10: 62,954,278 (GRCm39)	S1234P	probably damaging	Het
Nme5	A	G	18: 34,702,949 (GRCm39)	L113S	probably damaging	Het
Oprk1	T	C	1: 5,672,484 (GRCm39)	V207A	probably benign	Het
Or13a20	A	G	7: 140,231,927 (GRCm39)	T12A	probably benign	Het
Or4f52	T	C	2: 111,061,958 (GRCm39)	Y60C	probably damaging	Het
Otop2	A	G	11: 115,215,469 (GRCm39)	E130G	possibly damaging	Het
Pard6a	A	G	8: 106,429,023 (GRCm39)	K78R	probably benign	Het
Pbrm1	T	A	14: 30,840,809 (GRCm39)	L1637H	probably damaging	Het
Rims4	C	T	2: 163,705,849 (GRCm39)	V262M	possibly damaging	Het
Rnaset2b	T	A	17: 7,246,475 (GRCm39)	C27S	probably benign	Het
Rps24	A	G	14: 24,541,830 (GRCm39)	T6A	probably damaging	Het
Speer4a1	T	C	5: 26,240,123 (GRCm39)		probably null	Het
Srsf4	A	G	4: 131,628,370 (GRCm39)		probably benign	Het
Syt11	G	A	3: 88,655,147 (GRCm39)	R79C	probably damaging	Het
Tbx3	T	C	5: 119,819,018 (GRCm39)	V531A	probably benign	Het
Tmem132d	T	A	5: 127,861,934 (GRCm39)	D729V	probably damaging	Het
Ugcg	C	T	4: 59,207,798 (GRCm39)	P46S	probably benign	Het

Other mutations in Cdhr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00673:Cdhr1	APN	14	36,807,485 (GRCm39)	missense	probably benign	0.06
IGL01820:Cdhr1	APN	14	36,807,536 (GRCm39)	missense	probably benign	0.11
IGL02469:Cdhr1	APN	14	36,807,557 (GRCm39)	missense	possibly damaging	0.68
IGL03373:Cdhr1	APN	14	36,818,257 (GRCm39)	missense	possibly damaging	0.89
IGL03055:Cdhr1	UTSW	14	36,817,054 (GRCm39)	missense	probably benign	0.07
PIT4494001:Cdhr1	UTSW	14	36,804,813 (GRCm39)	missense	probably benign	0.07
R0110:Cdhr1	UTSW	14	36,802,633 (GRCm39)	missense	probably damaging	0.99
R0219:Cdhr1	UTSW	14	36,801,558 (GRCm39)	missense	possibly damaging	0.82
R0265:Cdhr1	UTSW	14	36,803,333 (GRCm39)	missense	probably benign	0.02
R0450:Cdhr1	UTSW	14	36,802,633 (GRCm39)	missense	probably damaging	0.99
R0510:Cdhr1	UTSW	14	36,802,633 (GRCm39)	missense	probably damaging	0.99
R0522:Cdhr1	UTSW	14	36,815,957 (GRCm39)	critical splice donor site	probably null
R0788:Cdhr1	UTSW	14	36,809,332 (GRCm39)	critical splice donor site	probably null
R0880:Cdhr1	UTSW	14	36,802,591 (GRCm39)	missense	possibly damaging	0.53
R1253:Cdhr1	UTSW	14	36,801,582 (GRCm39)	missense	probably benign
R1604:Cdhr1	UTSW	14	36,817,050 (GRCm39)	missense	probably benign	0.29
R1968:Cdhr1	UTSW	14	36,801,682 (GRCm39)	missense	probably benign	0.00
R2064:Cdhr1	UTSW	14	36,817,062 (GRCm39)	missense	probably benign	0.10
R2248:Cdhr1	UTSW	14	36,803,334 (GRCm39)	missense	probably benign
R3843:Cdhr1	UTSW	14	36,806,884 (GRCm39)	missense	probably benign	0.03
R4178:Cdhr1	UTSW	14	36,804,896 (GRCm39)	splice site	probably null
R4205:Cdhr1	UTSW	14	36,802,461 (GRCm39)	missense	probably benign	0.00
R4681:Cdhr1	UTSW	14	36,818,194 (GRCm39)	missense	probably benign	0.01
R5039:Cdhr1	UTSW	14	36,801,600 (GRCm39)	missense	probably benign	0.02
R5088:Cdhr1	UTSW	14	36,811,422 (GRCm39)	missense	probably benign	0.08
R5383:Cdhr1	UTSW	14	36,810,964 (GRCm39)	missense	possibly damaging	0.94
R5507:Cdhr1	UTSW	14	36,804,802 (GRCm39)	missense	probably damaging	0.98
R5933:Cdhr1	UTSW	14	36,811,419 (GRCm39)	missense	probably benign	0.01
R6074:Cdhr1	UTSW	14	36,801,600 (GRCm39)	missense	probably benign	0.02
R6291:Cdhr1	UTSW	14	36,811,422 (GRCm39)	missense	probably benign	0.31
R6449:Cdhr1	UTSW	14	36,812,554 (GRCm39)	missense	probably benign	0.35
R6890:Cdhr1	UTSW	14	36,807,602 (GRCm39)	missense	probably damaging	1.00
R6891:Cdhr1	UTSW	14	36,819,334 (GRCm39)	splice site	probably null
R7653:Cdhr1	UTSW	14	36,804,158 (GRCm39)	missense	probably benign	0.27
R7740:Cdhr1	UTSW	14	36,811,337 (GRCm39)	missense	probably damaging	0.98
R7805:Cdhr1	UTSW	14	36,803,502 (GRCm39)	missense	probably benign	0.00
R8081:Cdhr1	UTSW	14	36,815,967 (GRCm39)	missense	probably benign	0.01
R8147:Cdhr1	UTSW	14	36,801,609 (GRCm39)	missense	probably benign	0.02
R8164:Cdhr1	UTSW	14	36,801,499 (GRCm39)	missense	probably damaging	1.00
R8283:Cdhr1	UTSW	14	36,804,737 (GRCm39)	missense	probably benign	0.00
R8343:Cdhr1	UTSW	14	36,813,935 (GRCm39)	missense	probably benign	0.00
R8848:Cdhr1	UTSW	14	36,802,531 (GRCm39)	missense	probably benign	0.21
R8938:Cdhr1	UTSW	14	36,809,405 (GRCm39)	missense	probably benign	0.17
R9031:Cdhr1	UTSW	14	36,815,976 (GRCm39)	missense	probably benign
R9035:Cdhr1	UTSW	14	36,810,924 (GRCm39)	missense	possibly damaging	0.69
R9206:Cdhr1	UTSW	14	36,802,505 (GRCm39)	missense	probably damaging	0.99
R9246:Cdhr1	UTSW	14	36,801,654 (GRCm39)	missense	possibly damaging	0.46
R9274:Cdhr1	UTSW	14	36,802,564 (GRCm39)	missense	probably benign	0.15
R9366:Cdhr1	UTSW	14	36,811,463 (GRCm39)	missense	possibly damaging	0.92
R9401:Cdhr1	UTSW	14	36,820,055 (GRCm39)	missense	probably benign
R9545:Cdhr1	UTSW	14	36,817,016 (GRCm39)	missense	possibly damaging	0.51
R9713:Cdhr1	UTSW	14	36,801,751 (GRCm39)	missense	probably damaging	1.00
R9797:Cdhr1	UTSW	14	36,803,462 (GRCm39)	missense	probably damaging	1.00
X0062:Cdhr1	UTSW	14	36,801,736 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTAGACCATGTTAGCCACTCCCC -3'
(R):5'- AATGGTGACACCAAGCCCAAGTAG -3'

Sequencing Primer
(F):5'- CCTACTGTGACAGCCACC -3'
(R):5'- agcctacaatctcagcactc -3'

Posted On

2014-01-15