Incidental Mutation 'R1210:Olfr1186'
ID100635
Institutional Source Beutler Lab
Gene Symbol Olfr1186
Ensembl Gene ENSMUSG00000082882
Gene Nameolfactory receptor 1186
SynonymsGA_x6K02T2Q125-50012960-50013871, MOR230-5
MMRRC Submission 039279-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R1210 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88518551-88526790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 88526276 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 231 (R231P)
Ref Sequence ENSEMBL: ENSMUSP00000151114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075025] [ENSMUST00000121619] [ENSMUST00000215912] [ENSMUST00000216978]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075025
AA Change: R231P

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074542
Gene: ENSMUSG00000057735
AA Change: R231P

DomainStartEndE-ValueType
Pfam:7tm_4 28 302 2.5e-51 PFAM
Pfam:7tm_1 38 284 4.8e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121619
AA Change: R231P

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215912
AA Change: R231P

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216978
AA Change: R231P

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 93.9%
  • 20x: 83.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Clec7a T C 6: 129,465,525 I180V probably damaging Het
Csf3 A G 11: 98,702,477 D140G probably damaging Het
Cwf19l2 T C 9: 3,430,810 S381P probably benign Het
Eef1b2 A G 1: 63,177,273 D21G probably damaging Het
Fam83a A T 15: 57,995,248 Y228F possibly damaging Het
Gm5422 A G 10: 31,250,723 noncoding transcript Het
Itga5 A G 15: 103,357,473 V149A possibly damaging Het
Lrrfip1 A G 1: 91,115,193 H440R probably benign Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mindy4 T A 6: 55,284,813 L569H possibly damaging Het
Mme A G 3: 63,343,606 K356R probably benign Het
Nfkb1 A G 3: 135,594,927 I626T probably benign Het
Olfr172 T C 16: 58,761,050 N42S probably damaging Het
Olfr38 T C 6: 42,762,667 V205A possibly damaging Het
Olfr720 T C 14: 14,176,029 T18A probably benign Het
Rock2 T A 12: 16,965,469 V789D probably damaging Het
Sav1 A G 12: 69,969,179 Y282H probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r89 T C 14: 51,454,970 F77L probably benign Het
Vps50 G A 6: 3,594,884 V816I probably damaging Het
Other mutations in Olfr1186
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Olfr1186 APN 2 88525760 missense possibly damaging 0.87
IGL01727:Olfr1186 APN 2 88525927 missense probably benign 0.03
IGL01790:Olfr1186 APN 2 88526423 missense probably damaging 0.99
IGL01868:Olfr1186 APN 2 88525715 missense possibly damaging 0.66
IGL03146:Olfr1186 APN 2 88526144 missense possibly damaging 0.90
IGL03378:Olfr1186 APN 2 88526154 nonsense probably null
R0053:Olfr1186 UTSW 2 88526163 missense probably damaging 1.00
R0829:Olfr1186 UTSW 2 88526228 missense probably damaging 1.00
R1754:Olfr1186 UTSW 2 88525815 missense probably damaging 0.99
R2260:Olfr1186 UTSW 2 88526386 missense possibly damaging 0.93
R3426:Olfr1186 UTSW 2 88525864 missense probably damaging 1.00
R3781:Olfr1186 UTSW 2 88526365 missense probably benign 0.23
R4737:Olfr1186 UTSW 2 88526225 missense probably damaging 1.00
R4908:Olfr1186 UTSW 2 88525910 missense probably damaging 1.00
R4932:Olfr1186 UTSW 2 88525735 missense probably benign 0.02
R5071:Olfr1186 UTSW 2 88526041 missense probably damaging 1.00
R5831:Olfr1186 UTSW 2 88526480 nonsense probably null
R6222:Olfr1186 UTSW 2 88499270 missense probably benign 0.34
R6370:Olfr1186 UTSW 2 88499368 nonsense probably null
R6802:Olfr1186 UTSW 2 88525597 missense probably benign 0.02
R6931:Olfr1186 UTSW 2 88526194 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGCCTGGATAGGGTCGTGTATTCAC -3'
(R):5'- AAGAGGGTTGAGCACAGGTGTTCC -3'

Sequencing Primer
(F):5'- CATTCTGTGGCCCAAATGTG -3'
(R):5'- GCACAGGTGTTCCAATTGTATAAAAC -3'
Posted On2014-01-15