Incidental Mutation 'R1210:Ugcg'
ID100640
Institutional Source Beutler Lab
Gene Symbol Ugcg
Ensembl Gene ENSMUSG00000028381
Gene NameUDP-glucose ceramide glucosyltransferase
SynonymsEpcs21, Ugcgl, GlcT-1
MMRRC Submission 039279-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1210 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location59189257-59222833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59207798 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 46 (P46S)
Ref Sequence ENSEMBL: ENSMUSP00000030074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030074]
Predicted Effect probably benign
Transcript: ENSMUST00000030074
AA Change: P46S

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030074
Gene: ENSMUSG00000028381
AA Change: P46S

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 51 278 1.3e-26 PFAM
Pfam:Glyco_transf_21 106 278 8.4e-61 PFAM
Pfam:Glyco_trans_2_3 139 368 9.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155153
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 93.9%
  • 20x: 83.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the first glycosylation step in the biosynthesis of glycosphingolipids, which are membrane components containing lipid and sugar moieties. The product of this reaction is glucosylceramide, which is the core structure of many glycosphingolipids. [provided by RefSeq, Dec 2014]
PHENOTYPE: At embryonic day 7.5, embryos homozygous for a null mutation exhibit decreased size, markedly reduced extraembryonic tissues and a large increase in cells undergoing apoptosis. Mutants die by embryonic day 8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Clec7a T C 6: 129,465,525 I180V probably damaging Het
Csf3 A G 11: 98,702,477 D140G probably damaging Het
Cwf19l2 T C 9: 3,430,810 S381P probably benign Het
Eef1b2 A G 1: 63,177,273 D21G probably damaging Het
Fam83a A T 15: 57,995,248 Y228F possibly damaging Het
Gm5422 A G 10: 31,250,723 noncoding transcript Het
Itga5 A G 15: 103,357,473 V149A possibly damaging Het
Lrrfip1 A G 1: 91,115,193 H440R probably benign Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mindy4 T A 6: 55,284,813 L569H possibly damaging Het
Mme A G 3: 63,343,606 K356R probably benign Het
Nfkb1 A G 3: 135,594,927 I626T probably benign Het
Olfr1186 G C 2: 88,526,276 R231P possibly damaging Het
Olfr172 T C 16: 58,761,050 N42S probably damaging Het
Olfr38 T C 6: 42,762,667 V205A possibly damaging Het
Olfr720 T C 14: 14,176,029 T18A probably benign Het
Rock2 T A 12: 16,965,469 V789D probably damaging Het
Sav1 A G 12: 69,969,179 Y282H probably damaging Het
Vmn2r89 T C 14: 51,454,970 F77L probably benign Het
Vps50 G A 6: 3,594,884 V816I probably damaging Het
Other mutations in Ugcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Ugcg APN 4 59213865 missense possibly damaging 0.94
IGL01768:Ugcg APN 4 59217216 critical splice donor site probably null
IGL02636:Ugcg APN 4 59207763 missense possibly damaging 0.73
IGL02672:Ugcg APN 4 59218587 splice site probably benign
IGL02798:Ugcg APN 4 59220346 missense probably damaging 1.00
R0013:Ugcg UTSW 4 59213931 missense possibly damaging 0.82
R0013:Ugcg UTSW 4 59213931 missense possibly damaging 0.82
R0068:Ugcg UTSW 4 59217130 missense probably benign 0.16
R0068:Ugcg UTSW 4 59217130 missense probably benign 0.16
R0119:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0230:Ugcg UTSW 4 59189739 nonsense probably null
R0299:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0384:Ugcg UTSW 4 59220387 missense possibly damaging 0.91
R0499:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0645:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0688:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0726:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0802:Ugcg UTSW 4 59189685 missense probably benign 0.00
R0803:Ugcg UTSW 4 59189685 missense probably benign 0.00
R0811:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0812:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0828:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0831:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0944:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0945:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0947:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1104:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1209:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1252:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1253:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1255:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1488:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1490:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1548:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1698:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1771:Ugcg UTSW 4 59207775 missense probably benign 0.05
R1776:Ugcg UTSW 4 59207775 missense probably benign 0.05
R1781:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1794:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1840:Ugcg UTSW 4 59219517 missense probably damaging 1.00
R1942:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2228:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2229:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2237:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2239:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2314:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2337:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2338:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2340:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2422:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2426:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2433:Ugcg UTSW 4 59207876 missense possibly damaging 0.89
R2680:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3076:Ugcg UTSW 4 59213922 missense probably damaging 1.00
R3078:Ugcg UTSW 4 59213922 missense probably damaging 1.00
R3689:Ugcg UTSW 4 59211883 missense probably benign 0.16
R3732:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3732:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3733:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3766:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3767:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3768:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3769:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3771:Ugcg UTSW 4 59189690 missense probably benign
R3847:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3848:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3916:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3917:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3958:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3959:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4023:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4024:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4025:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4065:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4066:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4427:Ugcg UTSW 4 59219555 missense probably benign 0.02
R5842:Ugcg UTSW 4 59219545 missense possibly damaging 0.93
R6012:Ugcg UTSW 4 59220272 missense probably damaging 0.96
R6080:Ugcg UTSW 4 59218524 missense possibly damaging 0.70
R6762:Ugcg UTSW 4 59219530 missense possibly damaging 0.86
Y4336:Ugcg UTSW 4 59207798 missense probably benign 0.17
Y4337:Ugcg UTSW 4 59207798 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGGTTTCCTTGTCAGAAAGATGTCAGC -3'
(R):5'- CCCACGATGTAGCCCATCTCTCATAG -3'

Sequencing Primer
(F):5'- cccccctcttcaaacaaaaac -3'
(R):5'- GTAGCCCATCTCTCATAGGGATAG -3'
Posted On2014-01-15