Incidental Mutation 'R1210:Clec7a'
ID100648
Institutional Source Beutler Lab
Gene Symbol Clec7a
Ensembl Gene ENSMUSG00000079293
Gene NameC-type lectin domain family 7, member a
SynonymsClecsf12, dectin-1, beta-glucan receptor, beta-GR, BGR
MMRRC Submission 039279-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R1210 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location129461591-129472777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129465525 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 180 (I180V)
Ref Sequence ENSEMBL: ENSMUSP00000107707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112076] [ENSMUST00000184581] [ENSMUST00000195589]
PDB Structure
STRUCTURE OF MURINE DECTIN-1 [X-RAY DIFFRACTION]
STRUCTURE OF MURINE DECTIN-1 [X-RAY DIFFRACTION]
STRUCTURE OF MURINE DECTIN-1 [X-RAY DIFFRACTION]
DECTIN-1 IN COMPLEX WITH BETA-GLUCAN [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000112076
AA Change: I180V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107707
Gene: ENSMUSG00000079293
AA Change: I180V

DomainStartEndE-ValueType
transmembrane domain 46 68 N/A INTRINSIC
CLECT 119 241 2.01e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184581
AA Change: I135V

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139167
Gene: ENSMUSG00000079293
AA Change: I135V

DomainStartEndE-ValueType
low complexity region 48 69 N/A INTRINSIC
CLECT 74 196 2.01e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000195589
AA Change: I180V

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141234
Gene: ENSMUSG00000079293
AA Change: I180V

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
CLECT 118 240 2.01e-24 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 93.9%
  • 20x: 83.8%
Validation Efficiency
MGI Phenotype Mutations in this gene result in increased susceptibility and defective inflammatory responses in response to fungal infection.
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Csf3 A G 11: 98,702,477 D140G probably damaging Het
Cwf19l2 T C 9: 3,430,810 S381P probably benign Het
Eef1b2 A G 1: 63,177,273 D21G probably damaging Het
Fam83a A T 15: 57,995,248 Y228F possibly damaging Het
Gm5422 A G 10: 31,250,723 noncoding transcript Het
Itga5 A G 15: 103,357,473 V149A possibly damaging Het
Lrrfip1 A G 1: 91,115,193 H440R probably benign Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mindy4 T A 6: 55,284,813 L569H possibly damaging Het
Mme A G 3: 63,343,606 K356R probably benign Het
Nfkb1 A G 3: 135,594,927 I626T probably benign Het
Olfr1186 G C 2: 88,526,276 R231P possibly damaging Het
Olfr172 T C 16: 58,761,050 N42S probably damaging Het
Olfr38 T C 6: 42,762,667 V205A possibly damaging Het
Olfr720 T C 14: 14,176,029 T18A probably benign Het
Rock2 T A 12: 16,965,469 V789D probably damaging Het
Sav1 A G 12: 69,969,179 Y282H probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r89 T C 14: 51,454,970 F77L probably benign Het
Vps50 G A 6: 3,594,884 V816I probably damaging Het
Other mutations in Clec7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Clec7a APN 6 129465486 missense probably damaging 1.00
IGL01383:Clec7a APN 6 129472640 missense probably damaging 1.00
IGL01549:Clec7a APN 6 129472677 nonsense probably null
IGL01886:Clec7a APN 6 129463177 splice site probably benign
IGL01983:Clec7a APN 6 129465576 splice site probably benign
IGL02948:Clec7a APN 6 129465478 missense possibly damaging 0.92
R1469:Clec7a UTSW 6 129472572 splice site probably benign
R2126:Clec7a UTSW 6 129470955 missense probably benign 0.02
R2246:Clec7a UTSW 6 129467569 missense probably benign 0.27
R2887:Clec7a UTSW 6 129470997 missense probably damaging 1.00
R3901:Clec7a UTSW 6 129468914 missense possibly damaging 0.72
R5928:Clec7a UTSW 6 129465467 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGGAATCCCTTAGTCAGCACCAG -3'
(R):5'- AGATTGTCACCTTATGTGAACGTCCTTC -3'

Sequencing Primer
(F):5'- GGAGAGCATCCTTTACAGCCTC -3'
(R):5'- CTGTAAAAGGATTCATTCCGCC -3'
Posted On2014-01-15