Incidental Mutation 'R1210:Csf3'
ID100656
Institutional Source Beutler Lab
Gene Symbol Csf3
Ensembl Gene ENSMUSG00000038067
Gene Namecolony stimulating factor 3 (granulocyte)
SynonymsCsfg, MGI-IG, G-CSF
MMRRC Submission 039279-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R1210 (G1)
Quality Score178
Status Not validated
Chromosome11
Chromosomal Location98701263-98703629 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98702477 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 140 (D140G)
Ref Sequence ENSEMBL: ENSMUSP00000037762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017354] [ENSMUST00000038886] [ENSMUST00000100500] [ENSMUST00000138750]
Predicted Effect probably benign
Transcript: ENSMUST00000017354
SMART Domains Protein: ENSMUSP00000017354
Gene: ENSMUSG00000017210

DomainStartEndE-ValueType
Pfam:Med24_N 1 985 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000038886
AA Change: D140G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037762
Gene: ENSMUSG00000038067
AA Change: D140G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 31 54 N/A INTRINSIC
IL6 57 205 3.59e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100500
SMART Domains Protein: ENSMUSP00000098069
Gene: ENSMUSG00000017210

DomainStartEndE-ValueType
Pfam:Med24_N 1 1004 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125064
Predicted Effect probably benign
Transcript: ENSMUST00000138750
SMART Domains Protein: ENSMUSP00000120002
Gene: ENSMUSG00000017210

DomainStartEndE-ValueType
Pfam:Med24_N 1 46 1.4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156378
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 93.9%
  • 20x: 83.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that controls the production, differentiation, and function of granulocytes. The active protein is found extracellularly. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit chronic neutropenia, with severely reduced peripheral blood neutrophil levels, and reduced resistance to Listeria monocytogenes infection. Heterozygotes have intermediate neutrophil levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Clec7a T C 6: 129,465,525 I180V probably damaging Het
Cwf19l2 T C 9: 3,430,810 S381P probably benign Het
Eef1b2 A G 1: 63,177,273 D21G probably damaging Het
Fam83a A T 15: 57,995,248 Y228F possibly damaging Het
Gm5422 A G 10: 31,250,723 noncoding transcript Het
Itga5 A G 15: 103,357,473 V149A possibly damaging Het
Lrrfip1 A G 1: 91,115,193 H440R probably benign Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mindy4 T A 6: 55,284,813 L569H possibly damaging Het
Mme A G 3: 63,343,606 K356R probably benign Het
Nfkb1 A G 3: 135,594,927 I626T probably benign Het
Olfr1186 G C 2: 88,526,276 R231P possibly damaging Het
Olfr172 T C 16: 58,761,050 N42S probably damaging Het
Olfr38 T C 6: 42,762,667 V205A possibly damaging Het
Olfr720 T C 14: 14,176,029 T18A probably benign Het
Rock2 T A 12: 16,965,469 V789D probably damaging Het
Sav1 A G 12: 69,969,179 Y282H probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r89 T C 14: 51,454,970 F77L probably benign Het
Vps50 G A 6: 3,594,884 V816I probably damaging Het
Other mutations in Csf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02745:Csf3 APN 11 98702477 missense probably damaging 1.00
R1769:Csf3 UTSW 11 98702420 missense probably damaging 1.00
R2041:Csf3 UTSW 11 98701657 missense possibly damaging 0.49
R5112:Csf3 UTSW 11 98702923 missense probably damaging 1.00
R5795:Csf3 UTSW 11 98702027 missense probably damaging 1.00
R6825:Csf3 UTSW 11 98702447 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCCACCTACAAGCTGTGTC -3'
(R):5'- ACAGAGTCTGTCTGTCTCTCAGCC -3'

Sequencing Primer
(F):5'- ggaggagaagggggagg -3'
(R):5'- TGTCTCTCAGCCTGGAGGAAG -3'
Posted On2014-01-15