Incidental Mutation 'R1210:Vmn2r89'
ID100666
Institutional Source Beutler Lab
Gene Symbol Vmn2r89
Ensembl Gene ENSMUSG00000070448
Gene Namevomeronasal 2, receptor 89
SynonymsV2r10, V2r11
MMRRC Submission 039279-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R1210 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location51451962-51461293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51454970 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 77 (F77L)
Ref Sequence ENSEMBL: ENSMUSP00000124256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159611] [ENSMUST00000159734] [ENSMUST00000161670] [ENSMUST00000162998]
Predicted Effect probably benign
Transcript: ENSMUST00000159611
AA Change: F77L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124065
Gene: ENSMUSG00000070448
AA Change: F77L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 449 4.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159734
AA Change: F77L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000124256
Gene: ENSMUSG00000070448
AA Change: F77L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 420 1.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161670
SMART Domains Protein: ENSMUSP00000124261
Gene: ENSMUSG00000070448

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162998
SMART Domains Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

DomainStartEndE-ValueType
Pfam:Takusan 35 115 2.2e-25 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 93.9%
  • 20x: 83.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Clec7a T C 6: 129,465,525 I180V probably damaging Het
Csf3 A G 11: 98,702,477 D140G probably damaging Het
Cwf19l2 T C 9: 3,430,810 S381P probably benign Het
Eef1b2 A G 1: 63,177,273 D21G probably damaging Het
Fam83a A T 15: 57,995,248 Y228F possibly damaging Het
Gm5422 A G 10: 31,250,723 noncoding transcript Het
Itga5 A G 15: 103,357,473 V149A possibly damaging Het
Lrrfip1 A G 1: 91,115,193 H440R probably benign Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mindy4 T A 6: 55,284,813 L569H possibly damaging Het
Mme A G 3: 63,343,606 K356R probably benign Het
Nfkb1 A G 3: 135,594,927 I626T probably benign Het
Olfr1186 G C 2: 88,526,276 R231P possibly damaging Het
Olfr172 T C 16: 58,761,050 N42S probably damaging Het
Olfr38 T C 6: 42,762,667 V205A possibly damaging Het
Olfr720 T C 14: 14,176,029 T18A probably benign Het
Rock2 T A 12: 16,965,469 V789D probably damaging Het
Sav1 A G 12: 69,969,179 Y282H probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vps50 G A 6: 3,594,884 V816I probably damaging Het
Other mutations in Vmn2r89
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Vmn2r89 APN 14 51454965 missense probably damaging 1.00
IGL00990:Vmn2r89 APN 14 51455971 missense probably benign 0.14
IGL00990:Vmn2r89 APN 14 51457493 missense probably benign
IGL01991:Vmn2r89 APN 14 51452219 missense probably benign 0.00
IGL03073:Vmn2r89 APN 14 51456071 missense possibly damaging 0.95
IGL03085:Vmn2r89 APN 14 51452158 missense probably damaging 0.99
IGL03278:Vmn2r89 APN 14 51455100 missense probably damaging 0.99
R0115:Vmn2r89 UTSW 14 51456120 missense probably damaging 1.00
R0127:Vmn2r89 UTSW 14 51455703 missense probably damaging 0.98
R0391:Vmn2r89 UTSW 14 51455978 missense probably damaging 0.99
R0481:Vmn2r89 UTSW 14 51456120 missense probably damaging 1.00
R0538:Vmn2r89 UTSW 14 51457591 splice site probably null
R1332:Vmn2r89 UTSW 14 51455102 missense probably benign 0.00
R1660:Vmn2r89 UTSW 14 51456236 missense possibly damaging 0.48
R1959:Vmn2r89 UTSW 14 51457440 missense probably benign 0.22
R2876:Vmn2r89 UTSW 14 51455084 missense possibly damaging 0.47
R3410:Vmn2r89 UTSW 14 51456171 missense probably damaging 0.98
R4026:Vmn2r89 UTSW 14 51452043 start codon destroyed probably null 1.00
R4398:Vmn2r89 UTSW 14 51452094 missense probably damaging 1.00
R4700:Vmn2r89 UTSW 14 51457485 missense probably damaging 1.00
R4714:Vmn2r89 UTSW 14 51452231 missense probably damaging 0.97
R5162:Vmn2r89 UTSW 14 51456163 missense possibly damaging 0.88
R5294:Vmn2r89 UTSW 14 51455113 missense probably benign 0.00
R5811:Vmn2r89 UTSW 14 51456108 missense probably benign 0.12
R6087:Vmn2r89 UTSW 14 51457576 synonymous probably null
R6229:Vmn2r89 UTSW 14 51455721 missense probably benign 0.05
R6246:Vmn2r89 UTSW 14 51456046 missense probably damaging 1.00
R6572:Vmn2r89 UTSW 14 51455993 missense probably damaging 1.00
X0019:Vmn2r89 UTSW 14 51456415 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCGGGTGTTATCTAAGAAGGGCTGT -3'
(R):5'- CCCATTCAGTGTCACATGTTCTTACCA -3'

Sequencing Primer
(F):5'- GAACTGTAATCTAGTTCAAGGATGGC -3'
(R):5'- CCATGATGGTCCTGTAAGGC -3'
Posted On2014-01-15