Incidental Mutation 'R1191:Zswim2'
ID100773
Institutional Source Beutler Lab
Gene Symbol Zswim2
Ensembl Gene ENSMUSG00000034552
Gene Namezinc finger SWIM-type containing 2
Synonyms4933437F18Rik, MEX, 1700025P14Rik
MMRRC Submission 039263-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1191 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location83915079-83941228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 83923695 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 207 (V207G)
Ref Sequence ENSEMBL: ENSMUSP00000044913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038223] [ENSMUST00000152829]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038223
AA Change: V207G

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044913
Gene: ENSMUSG00000034552
AA Change: V207G

DomainStartEndE-ValueType
Pfam:SWIM 54 87 1.4e-7 PFAM
RING 147 198 8.3e-5 SMART
ZnF_ZZ 229 273 1.8e-5 SMART
RING 344 385 1.3e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152829
AA Change: V207G

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119439
Gene: ENSMUSG00000034552
AA Change: V207G

DomainStartEndE-ValueType
Pfam:SWIM 54 87 1.6e-10 PFAM
RING 147 198 1.69e-2 SMART
ZnF_ZZ 229 273 3.65e-3 SMART
Blast:RING 344 365 3e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155127
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 95.1%
  • 20x: 87.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd27 T C 7: 35,602,487 F144L probably damaging Het
C8b C T 4: 104,793,323 P377S probably damaging Het
Cfi C A 3: 129,868,527 T385N probably benign Het
Col15a1 G T 4: 47,254,083 G300* probably null Het
Crlf1 G A 8: 70,498,828 C119Y probably damaging Het
Dcaf4 A T 12: 83,535,967 S279C probably damaging Het
Gde1 A T 7: 118,705,441 H70Q probably damaging Het
Gpt2 A T 8: 85,509,272 N179I probably damaging Het
Grik5 G A 7: 25,058,325 Q410* probably null Het
Hspa2 C T 12: 76,405,881 R450W probably damaging Het
Idh3b A T 2: 130,281,890 M118K probably benign Het
Ighv5-21 T C 12: 114,322,803 probably benign Het
Il12rb2 C T 6: 67,298,216 V642M possibly damaging Het
Iqcg A G 16: 33,049,943 V60A probably benign Het
Irx6 T A 8: 92,676,952 Y102N probably damaging Het
Itgb6 C T 2: 60,653,137 probably null Het
Mmp27 A T 9: 7,579,066 probably null Het
Olfr143 G T 9: 38,254,205 V263F probably damaging Het
Olfr175-ps1 T A 16: 58,824,559 Y50F probably benign Het
Olfr452 C A 6: 42,790,517 H159Q probably benign Het
Olfr50 T A 2: 36,793,338 M34K probably damaging Het
Olfr976 A T 9: 39,956,968 M1K probably null Het
Pcdhb16 A G 18: 37,479,873 R629G probably damaging Het
Pde3b A T 7: 114,519,575 M650L probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Skint3 T A 4: 112,235,742 M1K probably null Het
Strn T C 17: 78,692,426 Q127R possibly damaging Het
Taar2 T G 10: 23,941,029 W156G probably damaging Het
Trpt1 G T 19: 6,996,770 M45I probably benign Het
Ubap2l T C 3: 90,023,575 T357A probably damaging Het
Ubr3 C T 2: 70,021,181 R1831* probably null Het
Unc79 T A 12: 103,047,012 Y287* probably null Het
Utrn T A 10: 12,634,033 K2398N probably benign Het
Vav2 A T 2: 27,292,780 probably null Het
Vps9d1 A T 8: 123,247,967 H249Q possibly damaging Het
Vwf T A 6: 125,599,252 C432S probably damaging Het
Zfp369 T A 13: 65,291,962 Y153* probably null Het
Zfp760 C T 17: 21,723,305 P487L probably damaging Het
Other mutations in Zswim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Zswim2 APN 2 83923771 missense probably benign 0.00
IGL01140:Zswim2 APN 2 83915328 missense probably benign 0.06
IGL01362:Zswim2 APN 2 83915346 missense probably benign 0.09
IGL01768:Zswim2 APN 2 83917957 missense probably benign 0.00
IGL02166:Zswim2 APN 2 83915406 nonsense probably null
IGL02187:Zswim2 APN 2 83923638 missense probably damaging 0.98
IGL02239:Zswim2 APN 2 83938763 nonsense probably null
IGL02629:Zswim2 APN 2 83925209 missense possibly damaging 0.94
R0609:Zswim2 UTSW 2 83923659 missense probably benign 0.02
R0943:Zswim2 UTSW 2 83917998 missense possibly damaging 0.88
R0946:Zswim2 UTSW 2 83923759 missense probably benign 0.10
R1006:Zswim2 UTSW 2 83915393 missense probably damaging 0.97
R1309:Zswim2 UTSW 2 83938756 missense probably damaging 1.00
R1549:Zswim2 UTSW 2 83923748 missense probably benign 0.24
R1563:Zswim2 UTSW 2 83915282 missense possibly damaging 0.71
R1739:Zswim2 UTSW 2 83915340 nonsense probably null
R1994:Zswim2 UTSW 2 83915663 missense possibly damaging 0.95
R4039:Zswim2 UTSW 2 83915994 missense probably damaging 1.00
R4645:Zswim2 UTSW 2 83915547 missense probably benign 0.00
R4738:Zswim2 UTSW 2 83915395 missense probably benign 0.16
R4855:Zswim2 UTSW 2 83916843 critical splice donor site probably null
R4933:Zswim2 UTSW 2 83925227 missense probably damaging 1.00
R4963:Zswim2 UTSW 2 83925110 missense probably damaging 1.00
R5153:Zswim2 UTSW 2 83939666 missense possibly damaging 0.75
R5401:Zswim2 UTSW 2 83925245 missense possibly damaging 0.94
R5698:Zswim2 UTSW 2 83925183 missense possibly damaging 0.92
R6002:Zswim2 UTSW 2 83915688 missense probably damaging 0.98
R6396:Zswim2 UTSW 2 83923718 missense probably damaging 1.00
R6447:Zswim2 UTSW 2 83915113 unclassified probably null
R6646:Zswim2 UTSW 2 83915784 nonsense probably null
R6717:Zswim2 UTSW 2 83915409 missense probably benign 0.02
R6735:Zswim2 UTSW 2 83923761 missense probably benign 0.04
R6830:Zswim2 UTSW 2 83939684 missense probably damaging 1.00
R7056:Zswim2 UTSW 2 83920748 critical splice acceptor site probably null
R7088:Zswim2 UTSW 2 83915727 nonsense probably null
R7383:Zswim2 UTSW 2 83915328 missense possibly damaging 0.95
R7440:Zswim2 UTSW 2 83920719 missense probably damaging 1.00
X0018:Zswim2 UTSW 2 83941094 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCAGATGCACTGATGCTCAGA -3'
(R):5'- CTCCCACAGAGATTGCTCACATGTT -3'

Sequencing Primer
(F):5'- CTCAGAGCCATGAGCACTG -3'
(R):5'- GAAGCTACACTTATTCTGGCCTTATG -3'
Posted On2014-01-15