Incidental Mutation 'R1191:Rfwd3'
ID100809
Institutional Source Beutler Lab
Gene Symbol Rfwd3
Ensembl Gene ENSMUSG00000033596
Gene Namering finger and WD repeat domain 3
Synonyms
MMRRC Submission 039263-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.614) question?
Stock #R1191 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location111270944-111300222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 111288242 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 326 (R326Q)
Ref Sequence ENSEMBL: ENSMUSP00000043780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038739]
Predicted Effect probably damaging
Transcript: ENSMUST00000038739
AA Change: R326Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043780
Gene: ENSMUSG00000033596
AA Change: R326Q

DomainStartEndE-ValueType
low complexity region 222 243 N/A INTRINSIC
RING 288 331 3.78e-5 SMART
coiled coil region 355 403 N/A INTRINSIC
WD40 486 526 1.38e-2 SMART
WD40 529 568 6.43e-3 SMART
Blast:WD40 683 730 2e-12 BLAST
Blast:WD40 733 772 4e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212958
Meta Mutation Damage Score 0.244 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 95.1%
  • 20x: 87.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit female and male fertility (possibly infertility), gonad atrophy, oligospermia, failure of follicular development, increased cellular sensitivity to MMC treatment, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd27 T C 7: 35,602,487 F144L probably damaging Het
C8b C T 4: 104,793,323 P377S probably damaging Het
Cfi C A 3: 129,868,527 T385N probably benign Het
Col15a1 G T 4: 47,254,083 G300* probably null Het
Crlf1 G A 8: 70,498,828 C119Y probably damaging Het
Dcaf4 A T 12: 83,535,967 S279C probably damaging Het
Gde1 A T 7: 118,705,441 H70Q probably damaging Het
Gpt2 A T 8: 85,509,272 N179I probably damaging Het
Grik5 G A 7: 25,058,325 Q410* probably null Het
Hspa2 C T 12: 76,405,881 R450W probably damaging Het
Idh3b A T 2: 130,281,890 M118K probably benign Het
Ighv5-21 T C 12: 114,322,803 probably benign Het
Il12rb2 C T 6: 67,298,216 V642M possibly damaging Het
Iqcg A G 16: 33,049,943 V60A probably benign Het
Irx6 T A 8: 92,676,952 Y102N probably damaging Het
Itgb6 C T 2: 60,653,137 probably null Het
Mmp27 A T 9: 7,579,066 probably null Het
Olfr143 G T 9: 38,254,205 V263F probably damaging Het
Olfr175-ps1 T A 16: 58,824,559 Y50F probably benign Het
Olfr452 C A 6: 42,790,517 H159Q probably benign Het
Olfr50 T A 2: 36,793,338 M34K probably damaging Het
Olfr976 A T 9: 39,956,968 M1K probably null Het
Pcdhb16 A G 18: 37,479,873 R629G probably damaging Het
Pde3b A T 7: 114,519,575 M650L probably benign Het
Skint3 T A 4: 112,235,742 M1K probably null Het
Strn T C 17: 78,692,426 Q127R possibly damaging Het
Taar2 T G 10: 23,941,029 W156G probably damaging Het
Trpt1 G T 19: 6,996,770 M45I probably benign Het
Ubap2l T C 3: 90,023,575 T357A probably damaging Het
Ubr3 C T 2: 70,021,181 R1831* probably null Het
Unc79 T A 12: 103,047,012 Y287* probably null Het
Utrn T A 10: 12,634,033 K2398N probably benign Het
Vav2 A T 2: 27,292,780 probably null Het
Vps9d1 A T 8: 123,247,967 H249Q possibly damaging Het
Vwf T A 6: 125,599,252 C432S probably damaging Het
Zfp369 T A 13: 65,291,962 Y153* probably null Het
Zfp760 C T 17: 21,723,305 P487L probably damaging Het
Zswim2 A C 2: 83,923,695 V207G possibly damaging Het
Other mutations in Rfwd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Rfwd3 APN 8 111273075 missense possibly damaging 0.53
IGL02193:Rfwd3 APN 8 111273015 utr 3 prime probably benign
IGL02282:Rfwd3 APN 8 111293982 splice site probably benign
IGL02903:Rfwd3 APN 8 111278229 missense probably benign 0.00
PIT4468001:Rfwd3 UTSW 8 111282720 missense probably benign 0.19
R0254:Rfwd3 UTSW 8 111294023 missense probably benign
R0279:Rfwd3 UTSW 8 111282733 missense probably benign 0.00
R0531:Rfwd3 UTSW 8 111293989 critical splice donor site probably null
R1137:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1164:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1168:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1192:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1258:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1259:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1260:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1261:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1439:Rfwd3 UTSW 8 111278288 missense probably damaging 1.00
R1579:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1580:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1581:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1727:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1763:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1774:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1785:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R1786:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R2059:Rfwd3 UTSW 8 111297495 missense probably benign 0.20
R2130:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R2132:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R2133:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R2145:Rfwd3 UTSW 8 111282613 missense probably benign
R2174:Rfwd3 UTSW 8 111283343 missense probably damaging 0.98
R3897:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R4625:Rfwd3 UTSW 8 111276358 missense probably benign 0.01
R5121:Rfwd3 UTSW 8 111282753 splice site probably null
R5480:Rfwd3 UTSW 8 111273832 missense probably damaging 0.96
R5781:Rfwd3 UTSW 8 111273084 missense probably benign 0.02
R7417:Rfwd3 UTSW 8 111273069 missense probably benign 0.03
Z1088:Rfwd3 UTSW 8 111297606 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCGCAGGGATCGGGCATAAATGAC -3'
(R):5'- TGTTTAAGGCTCCACCTCAGACACC -3'

Sequencing Primer
(F):5'- TGACAACGATGTCACTGTGC -3'
(R):5'- Acacccccatccccacc -3'
Posted On2014-01-15