Incidental Mutation 'R1192:Arrdc1'
ID100858
Institutional Source Beutler Lab
Gene Symbol Arrdc1
Ensembl Gene ENSMUSG00000026972
Gene Namearrestin domain containing 1
Synonyms
MMRRC Submission 039264-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R1192 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location24925352-24935252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24926140 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 284 (I284V)
Ref Sequence ENSEMBL: ENSMUSP00000028349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028349] [ENSMUST00000102935] [ENSMUST00000133934] [ENSMUST00000142887] [ENSMUST00000144963]
Predicted Effect probably benign
Transcript: ENSMUST00000028349
AA Change: I284V

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028349
Gene: ENSMUSG00000026972
AA Change: I284V

DomainStartEndE-ValueType
Pfam:Arrestin_N 7 139 8.5e-19 PFAM
Arrestin_C 162 286 1.19e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102935
AA Change: I283V

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099999
Gene: ENSMUSG00000026972
AA Change: I283V

DomainStartEndE-ValueType
Pfam:Arrestin_N 7 139 4.1e-31 PFAM
Arrestin_C 162 285 2.7e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129784
Predicted Effect probably benign
Transcript: ENSMUST00000132074
SMART Domains Protein: ENSMUSP00000116352
Gene: ENSMUSG00000026972

DomainStartEndE-ValueType
Blast:Arrestin_C 2 84 4e-48 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133396
Predicted Effect probably benign
Transcript: ENSMUST00000133934
SMART Domains Protein: ENSMUSP00000117695
Gene: ENSMUSG00000026972

DomainStartEndE-ValueType
Pfam:Arrestin_N 38 102 1.4e-16 PFAM
Pfam:Arrestin_C 125 210 1.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142887
SMART Domains Protein: ENSMUSP00000117372
Gene: ENSMUSG00000026972

DomainStartEndE-ValueType
Pfam:Arrestin_N 6 95 2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144963
SMART Domains Protein: ENSMUSP00000114684
Gene: ENSMUSG00000026972

DomainStartEndE-ValueType
Blast:Arrestin_C 3 58 5e-21 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156706
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 97% (32/33)
MGI Phenotype PHENOTYPE: Homozygous null mouse embryonic fibroblasts exhibit reduced extracellular vesicle release. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahrr T A 13: 74,214,403 M326L probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankmy1 T C 1: 92,883,894 T591A probably damaging Het
Anks4b A T 7: 120,174,066 I50L probably benign Het
Arhgef3 C A 14: 27,379,706 T133N probably damaging Het
Ccdc88a T A 11: 29,504,049 D717E possibly damaging Het
Cdh22 A T 2: 165,135,283 F439I probably damaging Het
Creld1 G T 6: 113,489,479 C169F probably damaging Het
Ctsq T A 13: 61,039,045 N78I probably damaging Het
Eif4g3 T A 4: 138,171,186 H1089Q probably damaging Het
Eri2 G T 7: 119,792,317 D41E probably damaging Het
Exosc9 C T 3: 36,552,755 probably benign Het
Galnt14 C T 17: 73,545,138 probably benign Het
Gen1 C T 12: 11,255,218 G192D probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ints14 T C 9: 64,966,763 V99A possibly damaging Het
Iqsec1 G A 6: 90,671,976 probably benign Het
Jarid2 G T 13: 44,906,545 R713L probably damaging Het
Nans T C 4: 46,502,430 probably benign Het
Nkiras2 T C 11: 100,625,980 probably null Het
Obscn A T 11: 59,067,199 D3558E probably benign Het
Olfr798 C T 10: 129,626,037 S8N probably benign Het
Palb2 G A 7: 122,128,209 T146M probably benign Het
Pcgf3 T C 5: 108,486,188 V104A probably benign Het
Polr3e A G 7: 120,933,308 D189G probably benign Het
Rfc1 T C 5: 65,293,911 K278R probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Shcbp1l T A 1: 153,425,507 I95N possibly damaging Het
Shox2 G A 3: 66,973,910 Q246* probably null Het
Slc16a4 G C 3: 107,298,873 E86D probably benign Het
Tubgcp2 A G 7: 140,029,838 V202A probably benign Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Other mutations in Arrdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Arrdc1 APN 2 24926152 missense possibly damaging 0.93
IGL02510:Arrdc1 APN 2 24935100 missense probably damaging 1.00
IGL03307:Arrdc1 APN 2 24926342 missense probably damaging 0.99
R1466:Arrdc1 UTSW 2 24925795 missense probably benign 0.04
R1466:Arrdc1 UTSW 2 24925795 missense probably benign 0.04
R1550:Arrdc1 UTSW 2 24926339 missense probably damaging 1.00
R1584:Arrdc1 UTSW 2 24925795 missense probably benign 0.04
R2061:Arrdc1 UTSW 2 24926352 nonsense probably null
R2157:Arrdc1 UTSW 2 24926975 missense probably damaging 1.00
R4904:Arrdc1 UTSW 2 24926664 missense possibly damaging 0.93
R4946:Arrdc1 UTSW 2 24925848 missense probably benign 0.36
R5632:Arrdc1 UTSW 2 24927828 missense probably benign 0.01
R5766:Arrdc1 UTSW 2 24926405 missense probably damaging 0.99
R6875:Arrdc1 UTSW 2 24925665 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TCTAGCAGGGCTTCCAACCTGAAC -3'
(R):5'- CAGTGGCAAGAACAGATCCTGGTG -3'

Sequencing Primer
(F):5'- CTCAGTGGTGGTGACAGACAC -3'
(R):5'- AACAGATCCTGGTGCCTGC -3'
Posted On2014-01-15